На правах рукописи КОРНЕЕВА Вера Анатольевна. Инактивация фактора свертывания крови XIIA ингибитором трипсина из CHFI – это канонический ингибитор сериновых протеаз (фXIIа – сериновая протеаза).


Чтобы посмотреть этот PDF файл с форматированием и разметкой, скачайте его и откройте на своем компьютере.
ФЕДЕРАЛЬНОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ НАУКИ

ЦЕНТР ТЕОРЕТИЧЕСКИХ ПРОБЛЕМ

ФИЗИКО
-
ХИМИЧЕСКОЙ ФАРМАКОЛОГИИ РАН

______________________________________________________________________


На правах рукописи


КОРНЕЕВА Вера Анатольевна



Инактивация фактора свертывания к
рови XIIA
ингибитором трипсина из кукурузы



Специальность
03.01.04


биохимия




Диссертация на соискание ученой степени

кандидата биологических наук






Научный руководитель:

докт
ор физико
-
математических наук,
профессор М.А. Пантелеев






Москва
,

201
5
2



Оглавление

ВВЕДЕНИЕ

................................
................................
................................
.................

4

ГЛАВА 1. ОБЗОР ЛИТЕР
АТУРЫ

................................
................................
..........

8

1.1. Сериновые протеазы. Механизм действия сериновых протеаз

.......................

8

1.2. Контактный путь активации свертывания

................................
......................

11

1.2.1. Актив
ация фактора
XII

................................
................................
.................

11

1.2.2. Физиологическая роль ф
XII

................................
................................
.........

14

1.2.3. Роль контактной активации в патологии

................................
.....................

17

1.3. Ингибиторы контактной активации

................................
................................

18

1.3.1. Плазменные ингибиторы ф
XIIa

................................
................................
....

18

1.3.2. Бел
ковые ингибиторы ф
XIIa

неплазменного происхождения
....................

20

1.3.3. Стандартный механизм ингибирования сериновых протеаз

......................

22

1.4. Ингиби
тор трипсина из кукурузы

................................
................................
...

26

ПОСТАНОВКА ЗАДАЧИ

................................
................................
.......................

28

ГЛАВА 2. МАТЕРИАЛЫ И

МЕТОДЫ

................................
................................

30

2.1. Используемые реактивы

................................
................................
...............

30

2.2. Подбор праймеров, полимеразная цепная реакция и сайт
-
направленный
мутагенез

................................
................................
................................
..............

34

2.3. Трансформация клеток штамма
-
продуцента плазмидными конструкциями

................................
................................
................................
...............................

35

2.4. Экспрессия и детекция рекомбинантных ингибиторов

..............................

36

2.5. Очистка рекомбинантных ингибиторов

................................
.......................

37

2.6. Измерение ингибирующей активности

................................
........................

38

2.7. Подготовка пространственных структ
ур CHFI и его мутантов для
проведения докинга

................................
................................
.............................

40

2.8. Молекулярная динамика

................................
................................
...............

41

2.9. Подготовка модельной структуры фактора
XIIa

на основе гомологии

.....

42

3


2.10. Белок
-
белковый докинг

................................
................................
..............

43

2.11. Статистический анализ

................................
................................
...............

44

ГЛАВА 3. РЕЗУЛЬТАТЫ

................................
................................
.......................

45

3.1. Клонирование, экспрессия и очистка рекомбинантного
CHFI

...................

45

3.2. Измерение ингиб
ирующей активности

................................
........................

51

3.3. Моделирование взаимодействия протеаза
-
связывающей петли
CHFI

с
ингибируемыми протеазами

................................
................................
................

56

3.3.1. Под
готовка пространственных структур
CHFI

и его мутантов для
проведения докинга

................................
................................
.............................

56

3.3.2. Моделирование структуры ф
XIIa
. Докинг

................................
...............

59

ГЛАВА 4. ОБСУЖДЕНИЕ

................................
................................
.....................

67

ВЫВОДЫ

................................
................................
................................
..................

73

Благодарности

................................
................................
................................
......

74

СПИСОК ЛИТЕРАТ
УРЫ

................................
................................
......................

75





4


Введение


Сериновые протеазы широко распространены в природе и составляют около
трети всех известных протеолитических ферментов. К ним относят как эндо
-
, так
и экзопептидазы, принадлежащие к различным семействам
белков
.

Эти ферменты
участвуют в различных процессах, таких как пищеварение, оплодотворения,
активации комплемента, апоптоз, иммунный ответ и
т.д.

[1]
.

Плазмен
ное звено свертывания крови так
же находится под управлением
каскада сериновых
протеаз, активирующих друг друга путем
протеолитического

расщепления. Плазменное свертывание может активировать
ся

по двум путям:
внешнему или пути тканевого фактора и внутреннему или контактному пути.
Внешний путь активируется в результате попадания трансм
ембранного белка


тканевого фактора в кровоток в месте повреждения сосуда. Такая активация
является физиологической и обеспечивает остановку кровотечений.

Активация плазменного свертывания по контактному пути начинается с
автоактивации фактора
XII


XII
)

при взаимодействии с отрицательно
-
заряженными поверхностями
:

in vivo

-

при контакте поверхностью
активированного тромбоцита или бактериальной клетки

[2

4]
,

внеклеточными
нуклеиновыми кислотами

и т.д.,

ex

vivo

-


от контакта со стентами, катетерами и
элементами сердечно
-
легочного шунтирования

и
in

vitro

-

при заборе крови в
результате контакта со стенками пластиковых и стеклянных пробирок

[5,6]
.

У
частие ф
XII

в поддержании гемостаза на сегодняшний день не вполне
ясн
о
,
а

его
вклад

в патол
огическое

тромбообразование был показан
экспериментально на животных моделях
FeCl
3
-
индуцированного тромбоза
[7]
,
коллаген
-
индуцированной т
ромбоэмболии легочной артерии,
лигирования аорты
[7,8]

и острого ишемического инсульта
[9]
.

Таким образом,
активный
фактор XII

(
ф
XII
a
)

представляет собой
многообещающую мишень для
создания новых
антитромботических препаратов,
т.к.
подавление работы данного фактора не сказывается на поддержании
5


гемостаза, но позволяет предотвратить патологическое
тромбообразование при
гиперкоагуляционных состояниях
.
Следовательно, исследование механизмов
ингибирования фактора
XIIa

и особенностей взаимодействия данной протеазы с
лучшими из существующими ингибиторов


очевидный и необходимый шаг на
пути создания новы
х антитромботических препаратов.

Ингибитора трипсина из кукурузы (corn

trypsin/factor XIIa inhibitor, CHFI)


канонический ингибитор сериновых протеаз, широко применяемый для
подавления контактной активации свертывания.
В данной работе будет
исследована р
оль протеаза
-
связывающей петли данного ингибитора в
специфическом

взаимодействии с активированным

фактор
ом

свертывания XII.


Целью данной работы

было выявление роли протеазы
-
связывающей петли
CHFI и его непетельных участков во взаимодействии с фXIIa. В
за
дачи

исследования входило

1.

получить рекомбинантный CHFI и серию его укороченных мутантов;
разработать протокол экспрессии CHFI и его мутантов в
E. coli

в
растворимой форме для последующей однофазной очистки;

2.

измерить константы ингибирования полученных мутан
тов по отношению к
фXIIa;

3.

построить модельную структуру фXIIa на основе гомологии;

4.

на основе известной рентгеновской структуры CHFI построить модельные
структуры мутантов CHFI методом молекулярной динамики;

5.

провести моделирование взаимодействия CHFI и его
мутантов с
трипсином, фXIIa и фXIa методом докинга.


Научная новизна.

В работе обнаружено, что изолированная протеаза
-
связывающая петля CHFI (синтетический пептид, С
-

и N
-
концы которого
соединены дисульфидной связью) не может подавлять активность фактора X
IIa,
6


сохраняя при этом способность ингибировать фактор XIa и трипсин. Таким
образом, было показано, что изолированная протеаза
-
связывающая петля CHFI
способна действовать как независимый структурный элемент и подавлять
активность некоторых протеаз (фактор
XIa и трипсин). В работе было также
показано, что минимальный фрагмент CHFI, сохраняющий ингибирующую
активность в отношении фXIIa, содержит аминокислотные остатки 12
-
108 (код
1BEA в базе данных PDB). Полученные результаты позволили сделать
предположения о

механизме ингибирования фактора XIIa CHFI: ингибирование
происходит по стандартному механизму
[10]
,

но с обязательным участием
некоторых участков CHFI вне протеаза
-
связывающей петли.


Научно
-
практическим значением

результатов данной работы является
вклад в понимание взаимодействия ингибиторов сериновых протеаз с
подавляемыми ферментами и механизма ингиб
ирования фактора
XIIa

ингибитором трипсина из кукурузы (
CHFI
) в частности. Разработанный в ходе
данной работы протокол получения рекомбинантного
CHFI

(глобулярный белок,
массой 14 кДа, содержащий 5 дисульфидных связей)
в
растворимой форме в
культуре
Escher
ichia

coli
.

также имеет научно
-
практическое значение.
Результаты данной работы могут быть использованы для создания новых
ингибиторов ф
XIIa

и других сериновых протеаз.

7


Положения, выносимые на защиту:


1.

Минимальный фрагмент
CHFI
, сохраняющий ингибирующую ак
тивность в
отношении ф
XIIa
, содержит аминокислотные остатки 12
-
108 (1
BEA
,
PDB
).

2.

Протеаза
-
связывающая петля
CHFI

принимает участие во взаимодействии с
ф
XIIa
, но не полностью определяет ингибирующую активность в отношении
этого
фактора

свертывания.

3.


Изолиро
ванная протеаза
-
связывающая петля
CHFI

действует как
независимый структурный элемент и ингибирует некоторые сериновые
протеазы
-

трипсин и ф
XIa
.

4.

Разработанный нами протокол экспрессии CHFI и его мутантов в
E.coli

впервые позволяет получать данный рекомбин
антный ингибитор в
функционально активной форме.

8



Глава 1. Обзор литературы

1.1. Сериновые протеазы. Механизм действия сериновых протеаз


Сериновые протеазы
-

одна из наиболее распространенных групп
протеолитических ферментов.
Название
"сериновые
» данное
семейство

протеаз
получил
о

вследствие того, что аминокислотный остаток серина входит в состав
активного центра данных протеаз и принимает непосредственное участие в
расщеплении субстрата.
Сериновые протеазы обнаружены у представителей всех
царств живых орг
анизмов. Данные ферменты могут выполнять множество
раз
личных функций, как в эу
-
, так и

прокариотах, участвуют в процессах
метаболизма, клеточной сигнализации и т.д
[1]
. Каскад сериновых протеаз,
активирующих друг друга путем протеолитиче
ского расщепления контролирует
свертывание крови и систему комплемента.

Сериновые протеазы расщепляют субстрат специфически: по определенным
аминокислотам.
Активный сайт сериновой протезазы имеет форму щели
, в
которую заходит субстрат.
Согласно
[11]

аминокислотные остатки в активном
сайте протеазы, с которыми связывается субстрат
, обозначают (S
i
,..., S
3
, S
2
, S
1
, S
1
',
S
2
', S
3
',..., S
j
).
Аминокислотные остатки субстрата обозначаются (P
i
, ..., P
3
, P
2
, P
1
,
P
1
', P
2
', P
3
', ..., P
j
)
; нумерация производится в направлении от
N
-

к С
-
концу
субстрата

(рис. 1)
.
Расщепляемая связь в субстрате находится между P
1

и P
1
'.

Типичная каталитическая триада сериновой протеазы формируется боковыми
цепями серина, гистидина и а
спартата.


9



Рисунок
1
.
Схема связывания субстрата с сериновой протеазой.
Протеаза
показана светло коричневым цветом, а аминокислотны
е

остатки субстрата


оливковым, по
[12]

с незначительными изменениями.


Механизм действия сериновых протеаз представляет собой ковалентный
катализ, где ковалентная связь формируется между субстратом и
аминокислотным остатком серина каталитической триады протеазы
. Протеол
из
проходит в два этапа (рис. 2).



Рисунок
2
. Механизм действия серин
ов
ых протеаз. Протеолиз
осуществляется
в

два этапа
.
Воспроизведено из

[13]
.


На первом этапе реакции
каталитический остаток серина производит
нуклеофильную атаку

карбонильного атома
углерода P
1
-
аминокислотного остатка
10


субстрата. Происходит образование

промежуточного продукта


ацил
-
фермента и
формируется новый

N
-
конец субстрата на
Р
1

'
-
аминокислотном остатке субстрата.
На втором этапе реакции молекула воды проводит вторую нуклеофильную атаку:
происходит гидролиз ацил
-
фермента. Каталитический серин приходит в
первоначальное состояние

(происходит регенерация свободной сериновой
протеа
зы
, а на P
1
-
аминокислотном остатке субстрата формируется новый С
-
конец

[11]
.


Каталитические аспартат и гистидин так же участвуют в процессе
протеолиза
[14]
.
Под действием гистидина из молекулы воды формируется
гидрокси
д
-
анион, который проводит вторую нуклеофильную атаку, а также
гистидин выступает в роли кислоты переносящей протон на отделяющуюся
группу на обоих этапах реакции.
Предпола
га
ют, что боковая
цепь

а
спартата
стабилизирует

про
теонированный остаток гистидина
, однако детали данного
взаимодействия все еще не вполне ясны

[15,16]
.

11


1.
2
. Контактный путь активации свертывания


1.
2
.1.
Активация фактора
XII


Активация плазменного свертывания по контактному пути начинается с
автоактивации ф
актора
XII


XII
)

при взаимодействии с отрицательно
-
заряженными поверхностями. Это может иметь место, к
ак
in

vitro

-

при заборе
крови в результате контакта со стенками пластиковых и стеклянных пробирок,
так и
ex

vivo

-

от контакта со стентами, катетерами и элементами сердечно
-
легочного шунтирования
[5,6]
, а также
in vivo

при контакте поверхностью
активированного тр
омбоцита или бактериальной клетки,
глюкозоаминогликанами
, коллагеном, внеклеточными нукл
еиновыми кислотами,
полифосфатами и т.д
[2

4]
.

Ф
XII

также может быть активирован высокомолекулярным кининогеном
(
HMWK
)
[17]
,
[18]
. Положительно заряженный гистидин
-
богатый домен
HMWK

в присутствии ионов цинка опосредует связывание комплекса
HMWK
-
ф
XII

с
поверхностью
[19,20]
.

Плазменная концентрация неактивного ф
XII

составляет около 0,3 мкМ. В
неактивной форме ф
XII

представляет собой од
ноцепочечный пептид массой 80
кДа. Ф
XII

состоит из нескольких доменов (рис
. 3
)
. Д
омен, обеспечивающий
связывание с отрицательно заряженной поверхностью, а также регуляторные
домены
расположены
на
N
-
конце фактора (52 кДа), а каталитический домен (28
кДа)


на С
-
конце.


12



Рисунок
3
. Доменная структура ф
XII
а.
Схема доменной структуры ф
XII
а
построена исходя из гомологии аминокослот
ной последовательности с
эпиде
рмальным фактором роста (
EGF
): эпидермальный фактор роста; тип
I

и тип
II

домены, гомологичные доменам фибронект
ина; крингл
-
домен,
аналогичный подобному домену фибронектина.
Расщепление ф
XII

в
результате активации
кал
ли
креином

или автоактивации переводит его в
проте
о
литически

активную форму, для которой ф
XI

и
прекалл
и
креин

являются субстратами. С
NH
2
-
концом ф
XII

мог
ут связываться как
эндогенные, так и экзогенные отрицательно заряженные вещества
(поверхности).


Независимо от способа активации переход неактивного фактора
XII

в
активный

(активированный фактор
XII



ф
XIIa
)

осуществляется посредством
гидролиза пептидной с
вязи между аминокислотными остатками Арг

353 и Вал
354. В результате чего белок разделяется на тяжелую и легкую цепи длиной 353 и
243 аминокислотных остатка, соответственно.
Тяжелая и легкая цепи остаются
связанными посредством дисульфидной связи между цис
теинами 359 и 486
[21]
.
Так происходит образование альфа
-
ф
XIIa
, который, в свою очередь, связывается с
отрицательно заряженной поверхностью и активирует фактор
XI


XI
), а также
переводит прекал
ли
креин в кал
ли
креин (активная форма). Образовавшийся
кал
ли
креин активирует ф
XII

c

п
олу
чением альфа
-
формы, а так
же переводит
альфа
-

ф
XII

в бета
-
форму (28 кДа каталитический домен) путем
13


протеолитического расщепления. Бета
-
ф
XII
а не способен активировать фактор
XI

(следующий фактор в каскаде ферментативных реакций плазменного
свертывания),
но сохраняет способность активировать калл
и
креин
[18]
.

Увеличение концентрации активных ф
XII

и калликреина происходит
экспоненциально и сдерживается плазменными ингибиторами, такими как С
-
1
ингибитор
[
22,23]
.


14


1.2
.2.
Физиологическая роль ф
XII


Образов
авшийся в результате активности

альфа
-
ф
XIIa

активный фактор
XI


XIa
) опосредует активацию следующих протеаз в каскаде плазменного
свертывания (фактор
IX
, фактор
X

и тромбин
[24,25]
), начиная с фактора
IX


IX
)

ис. 4
). Тромбин расщепляет растворимый плазменный белок фибриноген с
образованием фибрина и
переводит в активную форму
фактор
XIII


XIII
)
.
Фибрин полимеризуется с образованием длинных белковых нитей
-

фибрилл,
которые ковал
ентными сшивками соединяются в сеть
активным

ф
XIII
. Благодаря
формированию пространственной сети фибриновых фибрилл
и образуется
гелеобразный сгусто
к
[26]
.

Тем не менее, при повреждении кровеносного сосуда, т.е. в
«физиологических» условиях, активация плазменного свертывания происходит по
пути тканевого фактора (ТФ) (р
ис. 4
, справа). ТФ или тромбопластин


это
трансмембранный гликопротеин, который присутствуе
т на поверхности всех
клеток, за исключением клеток крови и эндотелиальных к
леток. Таким образом,
при повреж
дении сосуда кровь приходит в контакт с ТФ. Образуется комплекс
внешней теназы
-

ТФ
-
активный фактор
VII

(фактор
VII

(
ф
VII
)

автоактивируется
при взаи
модействии с ТФ), который далее активирует факторы
IX

и
X
, в
результате чего в месте повреждения сосуда формируется фибриновый сгусток
[27,28]
.


15



Рисунок
4
. Схема каскада плазменного свертывания. Слева путь контактной
активации

(желтые стрелки)
, спр
ава


путь тканевого фактора (оливковые
стрелки), общая часть каскада (зеленые стрелки)

по

[29]

с небольшими
изменениями.


Связь между двумя путями запуска плазменного свертывания (контактным
путем и путем тканевого фактора) осуществляется через способность альфа
-

и
бета
-
формы ф
XII
а активировать ф
VII

[30,31]
. При физиологических температурах
(около 37 °С) такая активация предотвращается плазменным С1
-
ингибитором

(C1INH)
, который теряет активность вблизи 0

°С. Это объясняет эффект
«холодовой» активации свертывания при пониженных температурах.

16


Еще одна физиоло
гическая роль ф
XIIa

заключается в его влиянии на
плотность сгустка. Альфа
-
ф
XIIa

может изменять структуру фибринового сгустка,
связываясь с фибрином своей тяжелой цепью, что приводит к образованию более
плотного сгустка, защищенного от фибринолиза
[32]
. Кроме того, ф
XIIa

опосредованно принимает участие в фибринолизе


процессе деградации
фибринового сгустка. Обе (а
льфа и бета) формы активного ф
XII

способны
активировать плазминоген с образованием плазмина


ключевого фермента
системы фибринолиза. Плазминоген протеолитически расщепляет фибриновые
нити сгустка, что приводит его к деградации
[33]
.

Ф
XII

также вовлечен в ангиогенез


процесс образования новых со
судов.
N
-
концевой домен ф
XII

и альфа
-
ф
XII
а может связываться с рецептором
эпидермального фактора роста (
EGFR
), что приводит к его активации и, как
следствие, к стимуляции роста эндотелиальных клеток
[20]
.

Вклад контактной активации в поддержании плазменного гемостаза до си
х
пор не вполне ясен. Дефицит ф
XII

впервые был обнаружен Ратноффом и Колопи
в 1955 г в крови Джона Хагемана (в честь которого ф
XII

также называют
фактором Хагемана), которая не сворачивалась в стеклянной пробирке
[34]
.
Однако, дефицит ф
XII

не оказывает заметного влияния на гемостаз, а пациенты и
экспериментальные животные с дефицитом ф
XII

не страдают от кровотечений
[7,35]
.


17


1.2
.3.
Роль контактной активации в патологии


Если участие ф
XII

в поддержании гемостаза на сегодняшний день не вполне
ясна, то его участие в патологическом тромбообразовании было показано
экспериментально на животных моделях
FeCl
3
-
индуцированного тромбоза
[7]
,
коллаген
-
индуцированной
тромбоэмболии легочной артерии,

лигирования аорты
[7,8]

и острого ишемического инсульта
[9]
.

Мыши с дефицитом ф
XII

(нок
-
аут по
соответствующему гену или животные дикого типа после введения ингибитора
ф
XII
) по результатам ногтевого и хвостового кровотечения не
отличались

от
контрольных животных дикого типа, что говорит об отсутствии наруше
ни
й
гемо
стаза. В то же время в
экспериментах

с индуцированным тромбозом мыши,
дефицитные по ф
XII
, были частично защищены от развития тромбоза: размер
тромба, объем ткани, поврежденной вследствие тромбоза, и смертность были
значительно ниже, чем у животных контроль
ной группы. Повышение
концентрации

ф
XII

в плазме экспериментальных животных до типичных
значений приводило к развитию обширного тромбоза
[7]
.
Выше описанные
эксперименты

позволяют говорить об участии ф
XII

в патологическом
формировании тромбов при гиперкоагуляционных состояниях системы гемостаза
[4]
.


18


1.
3
.

Ингибиторы контактной активации

1.3
.1.
Плазменные ингибиторы ф
XIIa


Контактная активация свертывания в кровеносном русле блокируется рядом
ингибиторов. К ним относятся С1
-
ингибит
ор (
C
1
INH
)
[23,36]
, антитромбин (
AT
),
α2
-
антитромбин, α2
-
макроглобулин
[37]

и гистидин
-
богатый гликопротеин
[38,39]
.

Антитромбин и
C
1
-
ингибитор представляют собой серпины, относящиеся к
семейству I04.001 α
-
1
-

ингибиторов протеаз
[40]
.
Ингибирование сериновых
протеаз серпинами необратимо и происходит с изменением конформации как
ингибитора, так и протеазы.
N
-
концевая петля ингибитора заходит в активный
сайт протеазы. Далее происходит проте
о
литический гидролиз пептидной связи в
петле инги
битора, что вызывает резкое изменение конформации ингибитора.
Такое конформационное изменение приводит к изменению структуры активного
центра протеазы, как следствие, гидролиз ацил
-
фермента не происходит, а
ингибитор с протеазой остаются ковалентно связанн
ыми
[41]
. В отличие от
C
1
INH

антитромбину для ингибирования ф
XIIa

требуется присутствие

кофактора


гепарина
[22]
. Гепарин
-

отрицательно заряженный сульфатированный
глюкозаминогликан, имеющий специфические АТ
-
связывающие сайты
[42]
.

Несвязанный с антитромбином гепарин напротив


провоцирует автоактивацию
ф
XII

[43]
. В экспериментах было показано,
C1INH

подавляет активность ф
XIIa

при т.н. поверхностной активации каолином или стеклом
[44]
. Если ф
XII

связывается с поверхностью активированных тромбоцитов (что также вызывает
его автоактивацию) или клетками эндотелия, это защищает ф
XII

от
ингибирования С1
-
ингибитором, но не антитромбином
[45]
.

Гистидин
-
богатый гликопротеин (
HRG
)
, подавляя контактную активацию,
действует, предположительно
, по другому
механизму
.
П
олагают

[20,46]
,
что
HRG

ингибирует альфа
-
ф
XII
а

через

связывание

с экзосайтом
на
его
поверхности
. Т
.к.
, с
одной стороны,

связывание гистидин богатого гликопротеина

с ф
XII
а в
19


п
рисутстви
и

ионов
Zn
2+

улучшает
ся

на 3

порядка, а
с другой стороны,

HRG

не
проявляет ингибирующей активности в отношении
ф
XII
а
при отсут
ст
вии
гепарина

[39]
,
данное
взаимодействие, вероятно, как

и в случае гепаран
-
сульфата
,
происходит через
N
-
концевой цистатин
-
домен
[20,46]
.
Это подавляет активность
альфа
-
ф
XII
а
в отношении
макромолекулярных
субстратов, так
их как
ф
XII

и ф
XI
,
но не
хромогенного субстрата (олигопептид)

[39]
.


20


1.3
.2.

Белковые ингибиторы ф
XIIa

неплазменного происхождения


Сериновые протеазы широко распространены в природе и составляют около
трети всех известных протеолитических ферментов
. К сериновым протеаз
ам
относят как эндо
-
, так и экзо
пептидазы, принадлежащие к разл
ичным семействам

белков. На данный момент в базе данных «
MEROPS
»

зарегистрировано

более 50
семейств сериновых протеаз
[47]
.

Эти ферменты участвуют в различных
процессах
,

таких как пищеварение, свертывания

крови, оплодотворения
,
активации комплемента,
апоптоз, иммунный ответ и т.д
[1]
.

В частности было
показан
о, что

протеазы играют важную роль в приспособительных реа
кций
прокариот к изменениям во

внеклеточной среде

[1]
,
в питании и
проникновение
бактерий в клетку
-
хозяина (инвазии)

[48]
. Вирулентность

многих патогенных
бактерий также обеспечивается сериновыми протеазами

[49,50
]
.

Вероятно, этим
может объясняться такое же широкое распространение ингибиторов сериновых
протеаз в природе. Так в базе данных «
MEROPS
»
[47]

насчитывается 38 семейств
ингибиторов сериновых протеаз, принадлежащих к

20 кланам. Сходство же
каталитических сайтов

сериновых протеаз позволяет находить ингибиторы
факторов свертывания

и ф
XIIa

в частности в природных источниках
: животных,
растительных и бактериальных

[51

57]
.
На данный момент описано 12
неплазменных ингибитора ф
XIIa
, принадлежащие к 5 различным семействам
ингибито
ров
, из которых только

один очевидно связан с подавлением
свертывания крови


четвертый домен белка
инфестин

(инфестин 4)

из желудка
кровососущ
его

насекомого
Triatoma infestans
[52]
. Другие

ингибиторы в
естественной ситуации

(в природе) не оказываются в контакте с кровью человека.

Природные белковые ингибиторы ф
XIIa

представляют
собой

небольшие
глобулярные белки с молекулярным весом от 3 до 16 кДа.
Т.к. эволюционно
данные ингибиторы появились не для выполнения функции подавле
ния
свертывания
, их селективность по отношению к фXIIa не высока, они также
подавляют активность других плазменных протез
:

фXIa, фXa, фIXa и тромбин
.

21


Таким образом, из 12 неплазменных ингибиторов селективно подавляют
активность

ф
XIIa

только ингибитор трипс
ина из кукурузы (
corn

Hageman

factor

inhibitor
,
CHFI
) и инфестин 4

с константами ингибирования
2,
5 нМ
[58]

и 78 пМ
[52]
, соответственно.

Данные ингибиторы подавляют активность протеаз по
стандартному механизму
[10]
, который будет рассмотрен подробнее.

22


1.3.3. Стандартный механизм ингибирования сериновых протеаз


Канонические ингибиторы сериновых протеаз, такие как
CHFI

и
инфестин
-
4, действуют по стандартному механизму
[10]
.

При этом ингибитор входит в
протеазу, как ключ в замок

(рис. 5)
. Канонические ингибиторы взаимодействуют
с
протеазой своей протеаза связывающей петлей. Петл
я входит в каталитический
сайт протеазы, подобно субстрату и связывается там с теми же субсайтами (
S
i
,
…,
S
3
,

S
2
,
S
1
,

S
1

,
S
2

,
S
3

, …
S
j

)
, что и субстрат

(рис. 1)
. Аминокислотные остатки
ингибитора, которые связываются с субсайтами,
обозначаю
т так же, как

и у
субстрата

(
P
i
, …,
P
3
,
P
2
,
P
1,

P
1
’,
P
2
’,
P
3
’, …
P
j
’)

[11]
.



Рисунок 5. Схема связывания канонического ингибитора с сериновой
протеазой. Ингибитор связывается с активным сайтом фермента в субстрат
-
подобным образом. Боковые цепи аминокислотных остатков выступающей
петли ингибитора связываются с субсайтами и каталитич
еским серином в
активном сайте ингибитора. По
[12]

с незначительными изменениями.


Когда канонический ингибитор связывается с сериновой протеазой, а его
петля заходит в каталитический сайт, связь
P
1
-
P
1
’ подвергается гидролизу.
Однако, гидролиз проходит очень медленно, а продукты реакции не
23


высвобождаются,

в результате пептидная связь
P
1
-
P
1
’ в петле ингибитора может
быть восстановлена
[13,59]
.
Важно отметить, что и гидро
лизованный
(двухцепочечный) канонический ингибитор способен
подавлять активность
сериновой

протеаз
ы

[
10]
.

Рассмотрим подробнее строение протеаза связывающей петли. У
канонических ингибиторов она значительно выступает

из белкового скаффолда и
представляет

собой довольно простой мотив. Собственно эпитоп формируется
шестью аминокислотными остатками
P
3

-

P
3

, которые и связываются с активным
сайтом протеазы.
Аминокислотные остатки, более удаленные от расщепляемой
связи
P
1
-

P
1
’ (
P
6



P
4

и
P
4



P
6
’) могут формировать т.н. контактный регион
,
который также может вносить значительный вклад в энергию связывания
инг
ибитора с протеазой
[60

62]
.


Важно подчеркнуть, что у канонических ингибиторов, в отличие от
ингибиторов сериновых протеаз д
р
угого типа
: неканонических и серпинов

(механизм работы серпинов описан в разделе 1.3.1.)
,
-

взаимодействие с протеазой
происходит только через протеаза
-
связывающ
ую петлю
,
при этом вторичные
сайты связывания за пределами каталитического сайта протеазы не формируются

(рис.6).

Интересно, что ингибиторы

Казаля

с нарушенной конформацией
протеаза
-
связывающей петли

связываются с протеазой

так

же
, как
неканонические ингиб
иторы: связываются с каталитическим сайтом, но п
ри этом
формируют дополнительные

сайты связывания с другими частями протеазы.
Этими вторичными сайтами во многом о
пределяется энергия связывания и
специфичность данных ингибиторов
[63]
.




24



Рисунок 6.
Примеры комплексов
"
сериновая протеаза:ингибитор
"

для
ингибиторов различных типов: канонический, неканонический и серпин.
Протеаза
-
связывающая петля

и боко
вая цепь Р1
-
аминокислотного остатка
CMTI

и альфа
-
1
-
антитрипсина, а также
N
-
конец

орнитодорина показаны
красным цветом, вторичные сайты связывания орнитодорина


оранжевым.
Элемент
ы вторичной структуры окрашены

сини
м

(бета
-
слои) и зеленым
(альфа
-
спирали).
П
о
[63]

с незначительными изменениями


Аминокислот
ные последовательности протеаза
-
связывающих

петель
канонических ингибиторов значительно варьируют
, за
исключением

представителей двух семейств

[64,65]
, однако

при этом конформация петли
остается канонической

(рис. 7)
.





25




Рисунок 7.
Суперпозиция основной цепи протеаза
-
связывающих петель
(участок Р
3
-
Р
3
’)

[63]
:

OMSVP
3 (
PDB
: 2
OVO
)



светло
-
серый
;
SSI

(3
SSI
)



серый и
BPTI

(PDB: 5
PTI
)


темно
-
серый.


Даже после расщепления
конформация протеаза
-
связывающей петли

остается практически неизменной, за исключением

локальных структурных
изменений около разрушенной пептидной связи
P
1
-

P
1


[66,67]
.

Подвижность
расщепленной петли также повышается
, однако структура белка в целом остается
неизменной

[68,69]
.


26


1.4. Ин
гибитор трипсина из кукурузы


Ингибитор трипсина из кукурузы (
corn

trypsin

inhibitor

/
Corn

Hageman

factor

inhibitor
,
CHFI
)


канонический ингибитор сериновых протеаз

с молекулярным
весом 14 кДа.
CHFI

принадлежит к семейству

злаковых ингибиторов сериновых
п
ротеаз

I
6, согласно классификации «
MEROPS
»
[47]
.
Зрелый белок состоит из 127
аминокислотных остатков
.
Как и другие канонические ингибиторы,
CHFI

взаимодействует с протеазами посредством выступающей протеаза
-
связывающей
петли
. Пептидная связь Р
1
-
Р
1
’ у данного ингибитора находится между
Арг34 и
Лей35
[70]
.

Согласно данным рентгенно
-
структурного анализа

[71]
,

CHFI

имеет
протеаза
-
связывающую петлю типичной формы, замкнутую дисульфидной
связью между цистеинами 20 и 44

(рис.
8

).




Рисунок
8
. Структура
CHFI
. Альфа спирали показаны зеленым, бета слои


коричневым, дисульфидные связи


розовым,
пептидная связь Р1
-
Р1’
междуАрг34 и Лей35


желтым цветом.

Визуализация выполнена в
программе «
Cn
3
d
»
[72]
.


27


Известно, что
CHFI

ингибирует
ф
XIIa

[73]
,

оказывая

при этом минимальное
влияние на другие факторы свертывания
.
В настоящий момент не
существует

кристаллической структуры комплекса ф
XIIa
-
CHFI
, однако
экспериментальные
данные указывают на то
, что ингибирование

происходит по стандартному
механизму
[10]
.
Было показано, что
CHFI

сохраняет ингибирующую активность в
отношении трипсина

[74,75]

и

ф
XIIa

[73,76]
,

как

в

интактной

(
одноце
почечной
)

форме
,
так

и

с

расщепленной

Р
1
-
Р
1

пептидной

связью

(двуцепочечная форма)
.
Двуцепочечная

форма
ингибитор
а сохраняет 20
-
25% ингибир
ующей активность
интактной
.



28



Постановка задачи

Активация по внутреннему пути начинается с

автоактивации фактора XII
(фXII) при его взаимодействии с отрицательно заряженными поверхностями. В
норме данный путь не является значимым этапом в поддержании гемостаза,
однако может приводить к патологическому формированию тромбов при
гиперкоагуляционны
х состояниях. Предотвращение а
к
тивации фXII или
ингибирование активированной формы фXII (фXIIа) также необходимо при
любых манипуляциях, приводящих кровь или плазму в контакт с чужеродными
поверхностями как
in

vivo
, так и
in

vitro
.

Ингибитор трипсина из к
укурузы (
Corn

Hageman

Factor

Inhibitor
,
CHFI
)
избирательно подавляет активность
ф
XII
а, оказывая при этом незначительное
воздействие на работу других факторов свертывания.

CHFI



это канонический
ингибитор сериновых проте
а
з (
ф
XII
а


сериновая протеаза).
Для

ингибиторов
данного типа характерно наличие протеаза
-
связывающей петли, выступающей на
поверхности белковой глобулы и взаимодействующей непосредственно с
каталитическими аминокислотными остатками в кармане протеазы. Такая
протеаза
-
связ
ы
вающая петля может
действовать как независимый структурный
элемент, сохраняя ингибирующую активность в отношении протеазы, что было
показано в экспериментах с синтетическими пептидами и природными
пептидными ингибиторами из слизи лягушки
Odorrana grahami

[77,78]
.

Таким образом, исследование роли протеаза
-
связывающей петли
ингибитора трипсина из кукурузы

в специфическом взаимодействии с
активированный фактор свертывания XII и поиск минимального фрагмента
данного ингибитора, способного подавлять

проте
о
литическую активность ф
XIIa
,
являются совершенно необходимыми для понимания механизмов ингибирования
контактной активации и разработки новых высоко селективных ингибиторов.

29


Принято считать, что канонические ингибиторы сериновых протеаз действуют по
субстрат


подобному механизму, взаимодействуя с активным сайтом фермента
своей протеаза
-
связывающей петлей. В данной работе мы исследовали роль
протеаза
-
связывающей петли ингибитора трипсина из кукурузы (corn

trypsin/factor XIIa inhibitor, CHFI)
в специфи
ческом взаимодействии с
активированный фактор свертывания XII (
ф
XIIa).

Целью данной работы

было выявление роли протеаз
а
-
связывающей петли
CHFI и его
в
непетельных участков во взаимодействии с фXIIa. В
задачи

исследования входило

1.

получить рекомбинантный CHFI

и серию его укороченных мутантов;
разработать протокол экспрессии CHFI и его мутантов в
Escherichia

с
oli

в
растворимой форме для последующей однофазной очистки;

2.

измерить константы ингибирования полученных мутантов по отношению
к
фXIIa;

3.

построить модельную

структуру фXIIa на основе гомологии с активатором
фактора роста гепатоцитов;

4.

на основе известной рентгеновской структуры CHFI построить модельные
структуры мутантов CHFI методом молекулярной динамики;

5.

провести моделирование взаимодействия CHFI и его мутан
тов с трипсином,
фXIIa и фXIa методом докинга.

30


Глава 2. Материалы и методы

2.1
.

Используемые реактивы

В работе были использованы следующие реактивы:



альфа
-
ф
XIIa (Haematologic Technologies, Essex Junction, VT,
США
);



ф
XIa (Haematologic Technologies, Essex J
unction, VT,
США
);



хромогенные субстраты
S
2302 (для ф
XIIa
),
S
2765 (для трипсина) и
S
2366 (для
ф
XIa
) (
Chromogenix
, США);



2
-
амино
-
2
-
гидроксиметил
-
пропан
-
1,3
-
диол (ТРИС) (
Sigma
,
St

Louis
,
MO
,
США);



бычий сывороточный альбумин (БСА) (
Sigma
,
St

Louis
,
MO
, США
);



фосфатный

буфер

(PBS) (Sigma, St Louis, MO,
США
);



Ni
-
NTA (
никель
-
нитрилоуксусная

кислота
)
-
агароза

(QIAGEN, GmbH,
Германия
)



у
ксусная

кислота

(Sigma, St Louis, MO,
США
);



с
оляная кислота
(Sigma, St Louis, MO,
США
);



а
криламид

/
бис
-
акриламид

(37:1) (Sigma,
St Louis, MO,
США
);



и
мидазол

(Sigma, St Louis, MO,
США
);



х
лорид

натрия

(Sigma, St Louis, MO,
США
);



г
идроксид

натрия

(Sigma, St Louis, MO,
США
);



т
етраметилэтилендиамин

(
ТЕМЕД
) (Sigma, St Louis, MO,
США
);



г
лицерин

(Sigma, St Louis, MO,
США
);



Кумасси бриллиан
товый синий (
R
-
250) (
Sigma
,
St

Louis
,
MO
, США);



а
гароза

(Sigma, St Louis, MO,
США
);



п
ептон

(BD Biosciences, San Jose, CA,
США
);



д
рожжевой

экстракт

(BD Biosciences, San Jose, CA,
США
);



а
гар

(BD Biosciences, San Jose, CA,
США
);



т
рипсин

из бычьей поджелудочно
й железы (
Sigma
,
St

Louis
,
MO
, США);

31




д
одецилсульфат натрия (
SDS
) (
Sigma
,
St

Louis
,
MO
, США);



б
ромистый

этидий

(BrEt) (Sigma, St Louis, MO,
США
);



м
еркаптоэтанол

(Sigma, St Louis, MO,
США
);



э
танол

(Sigma, St Louis, MO,
США
);



б
ромфеноловый синий
(Amerco,
США)



к
силенцианол

(Amerco,
США)



г
лицин

(Sigma, St Louis, MO,
США
);



и
зопропил
-
бета
-
D
-
тиогалактопиранозид

(
ИПТГ
) (Sigma, St Louis, MO,
США
);



п
ерсульфат

аммония

(Sigma, St Louis, MO,
США
);



ф
енилметилсульфонилфторид

(PMSF) (Thermo Fisher Scientific Inc,
США
)
;



эндо
нуклеазы

рестрикции

Bam
HI
и

Hind
III (
New England Biolabs,
США
)
;



T4
ДНК
-
лигаза

(
New England Biolabs,
США
)
;



ДНК
-
полимераза

«Vent® DNA
-
polymerase»

(
New England Biolabs,
США
)
;



и
нгибитор

трипсина

из

кукурузы

(corn trypsin inhibitor, CHFI
) (Enzyme
Research Labor
ato
ries,
США
).


Циклический синтетический пептид
CHFI
-
2

(
Цис
-
Арг
-
Три
-
Тир
-
Вал
-
Три
-
Сер
-
Арг
-
Три
-
Асп
-
Гли
-
Иле
-
Гли
-
Про
-
Арг
-
Иле
-
Про
-
Три
-
Про
-
Глу
-
Лей
-
Лиз
-
Арг
-
Арг
-
Цис
)
, представляющий собой изолированную протеаза
-
связывающую петлю
CHFI

был синтезирован

в ООО «Синэйр
о» (Москва, Россия) по нашему заказу.

Плазмида, содержащая синтетический ген
CHFI

была любезно предоставлена
д.б.н. В.Г. Луниным (Государственное учреждение Научно
-
исследовательский
институт эпидемиологии и микробиологии им. почетного академика Н.Ф.
Гама
ле
и

Российской академии медицинских наук).

Прочие реагенты были приобретены у фирмы
Sigma
-
Aldrich

(
St

Louis
,
MO
,
США).


32


В работе были использованы следующие
буферные растворы
:



б
уфер лизирования клеток
E
.
coli

при выделении белка (Буфер Л): 25мМ
ТРИС
-
HCl
, pH=8.0, 300 мМ NaCl,

лизоцим 1мг/мл, 10 мМ имидазол и
0,1
мМ

фенилметилсульфонилфторид

(PMSF)
;



б
уфер для промывания
Ni
-
NTA

колонки (Буфер К)
: 25мМ ТРИС
-
HCl,
pH=8.0, 300 мМ NaCl, лизоцим 1мг/мл,
5
0 мМ имидазол и 0,1 мМ
ф
енилметилсульфонилфторид (PMSF);



б
у
фер для элюции белка с
Ni
-
NTA

колонки (Буфер Э)
: 25мМ ТРИС
-
HCl,
pH=8.0, 300 мМ NaCl, лизоцим 1мг/мл,
20
0 мМ имидазол и 0,1 мМ
ф
енилметилсульфонилфторид (PMSF);



б
уфер для хранения рекомбинантных белков (Буфер Х)
: 110 мМ ТРИС
-
HCl,
pH=8.0, 250 мМ NaCl и 4 мМ
имидазол
;



б
уфер для проведения хромогенного теста ингибирования ф
XII
а,

ф
XIa

и
трипсина (Буфер ХТ):
110 мМ ТРИС
-
HCl, pH=8.0, 250 мМ NaCl и 1% БСА).



б
уфер Лэммли: ТРИС 30 г/л,
SDS

10 г/л, глицин 144 г/л;



б
уфер ТАЕ: ТРИС 40мМ, ЭДТА 1мМ, уксусна
я
кислота

-

до
достижения рН
7,6;



б
уфер для внесения образцов в ПААГ (Буфер В): Буфер для внесения
образцов в агарозный гель
GelPilot

DNA

Loading

Dye

(
QIAGEN
,
GmbH
,
Германия)
.


Штаммы

Escherichia coli

(E. coli)
:

Rosetta
-
gami

2 (
DE
3) (

EMD

Millipore
,
Darmstadt
, Германия)
был использован для
эксп
рессии рекомбинантных белков.
Генотип
Rosetta
-
gami

2 (
DE
3):
Δ
(
ara
-
leu
)7697
ΔlacX
74
ΔphoA

PvuII

phoR

araD
139
ahpC

galE

galK

rpsL

(
DE
3)
F
′ [
lac
+

lacI
q

pro
]
gor
522::
Tn

10
trxB

pRARE
2 (
Cam
R
,
Str
R
,
Tet
R
). Данный штамм является лизогеном
λDE
3 и имеет хромосомную копию гена Т7 РНК
-
полимеразы, находящегося под
контролем
lacUV
5 промотора.
Использованный

штамм
-
продуцент позволяет
33


проводить индуцировать экспрессию гетерологичного белка добавлением ИПТГ в
питательную среду.

34


2.2.

Подбор праймеро
в, полимеразная цеп
ная реакция и сайт
-
направленный

мутагенез

Плазмида
pLA
-
TA
, содержащая ген

CHFI

была использована в качестве
матрицы в полимеразной цепной реакции

(ПЦР)

для амплификации целевого гена
и последующего создания экспрессионного вектора на баз
е

коммерческой
плазмиды
pET
28
a
.
Прямой и обратный праймеры, использованные

в работе,

5′
-
TGCGGATCCTCTGCTGGTACCAGCTG
-
3′ и


5′
-
TGCAAGCTTAGATCTGCTCGGCATGG
-
3′

дополнительно вносили в ПЦР
-
продукт сайты распознавания для эндонуклеаз рестрикции
Bam
HI

и
Hind
III

(п
рямой и обратный праймер, соответственно).

Спе
циальные праймеры были
сконструированы для проведения сайт
-
направленного мутагенеза

(замены
нуклеотидов в триплете, кодирующем неспаренный цистеин) для каждого
рекомбинантного ингибитора.
ПЦР
-
сшивку

фрагментов

после сайт
-
направленного мутагенеза проводили по методу
[79]
, используя прямой и
обратный праймеры, а так же

два специальных праймера, специ
фических

для
каждой конструкции (табл
.
1)
.


Таблица
1
. Праймеры для сайт
-
направленного мутагенеза.



К
онструк
-
ция

праймеры
, 5’


3’

прямой

праймер для
мутагенеза


1

праймер для
мутагенеза

№2

обратный

CHFI
-
1234

GGATCCTCTGCT
GGTACC
AGCTG
CGTTCCGG

CAGGATAGACAGAGC
GGTGTTACGGCAGTA
AGCCGG GATGTC

TCCCGGCTTACTGCCG
TAACACCGCTCTGTCT
ATCCTGATG

AAGCTTTTAGGTA
GCTAAGTTGCATT
CAG

CHFI
-
2345

GAATTCATCCCG
CACAACCCGCT
G

GGTGCAACGGTCGTA
AGCCGGGATGTCAGC
CAGTTCA

CCGGCTTACGACCGTT
GCACCGCTCTG

AAGCTTAGATCTG
CTCGGCATGGT
AC
CACCA

CHFI
-
234

GAATTCATCCCG
CACAACCCGCT
G

GTGTTACGGTCGTAAG
CCGGGATGTCAGCC

GCTGACATCCCGGCTT
ACGACCGTAACAC

AAGCTTGGTAGCT
AAGTTGCATTCAG
CTTC

CHFI
-
123

GAATTCTCTGCT
GGTACCAGCTG
C

GATGTCAGCCAGTTCA
CGGTCGCAACGACGTT
TCAGTTCC

ATCCCGGCTTACTGCC
GTGACACCGCTCTGTC
TATCCTG

AAGCT
TACCACG
CTGAACTTCTCTC

CHFI
-
1245

GAATTCTCTGCT
GGTACCAGCTG
C

TCCAGAACCGACGGA
ATCGG

ACCGATTCCGTCGGTT
CTGG

AAGCTTAGATCTG
CTCGGCATGGTAC
CACCA

35


2.3.
Трансформация клеток штамма
-
продуцента плазмидными
конструкциями


Штамм
-
продуцент
E
.
coli

Rosetta
-
Gami

2
DE
3 был исп
ользован для
экспрессии рекомбинантных ингибиторов
. Трансформацию

проводили методом
теплового шока
[80]

с незначительными модификациями
.

Химически
компетентные клетки инкубировали на льду в течении 20 мин, затем в
стерильных условиях к клеткам добавляли 5 мкл лигазной смеси, содержащей
соответствующий экспрессионный вектор

и инкубировали на льду 30 мин.
Теп
ловой шок проводили в

водяной бане при температуре 40 °С в течение 20 с.
После теплового шока клетки немедленно переносили на лед.
На следующем
этапе каждую аликвоту клеток переносили в 0,5 мл питательной среды
SOC
.
Инкубировали

при 37 °С в течение 1 ч со
встряхиванием на шейкере.
Далее
проводили селекцию трансформантов
на твердой агаризованной среде
,
содержащей 25 мг/мл канамицина,

в чашках Петри
.
П
отенциальных

продуценты
отбирались по результатам пробной индукции в
4 мл питательной среды
LB
;
экспрессию ин
ициировали добавлением 1мМ ИПТГ. Наработку белка проводили
в течение 2,5 ч при 37 °С.

Наличие вставки целевого гена

у положительных трансформантов
подтверждали секвенированием.

В качестве сиквен
совых праймеров
использовались
, комплиментарные к вектору
pET
28
a
, стандартные Т7 праймер
ы
прямой

5’
-

TAATACGACTCACTATAGGG
-
3’ и обратный

5’
-

GCTAGTTATTGCTCAGCGG
-
3’.


36


2.4.
Экспрессия и
детекция рекомбинантных ингибиторов


Рекомбинантные ингибиторы произ
водили

путем индукции

экспрессии
целевого белка в соответствующ
ем штамме
-
продуценте.
Клетки штамма
-
продуцента
E
.
coli

Rosetta
-
Gami

2
DE
3

каждого

ингибитора

рассевали из музея на
твердую агаризованную питательную среду, содержащую

25 мг/мл канамицина,

в
чашки

Петри

для получения единичных колоний.

Единичную колонию кл
еток использовали для инокуляции
4

мл жидкой
питательной среды
LB
, содержащей 25 мг/мл канамицина, и культивировали в
течение ночи при 37 °
C
.
Полученную культуру использовали
в качестве
ин
окулята

(
и
нокулят разводили в 50 раз)

для
1,5 л жидкой среды
LB
, сод
ержащей
25 мг/мл канамицина
.
Клетки культивировали при 37 °
C

до достижения

оптической плотности культуры 0,6
-
0,7
на длине волны 600 нм.

Экспрессию
индуцировали добавлением ИПТГ в питательную среду до достижения конечной
концентрации 0,02
мМ, после чего кул
ьтивирование продолжали при 25 °
C

в
течение 20 ч.

Образцы культуры центрифугировали при 3000
×
g
, надосадочную жидкость
декантировали, а клеточный осадок

ресуспензировали в буфере В

и инкубировали
10 мин при 95 °
C
.
Затем наличие целевого белка в клеточном ли
зате проверяли
методом денатурирующего электрофореза в
12%
акриламидном геле

по Лэммли в
камере
«
MiniProteanTetra
»

(
BioRad
,
США) в соответствии с рекомендациями
производителя.

Прописи использованных растворов приведены в разделе
«2.1.
Используемые реактивы
».


Окрашивание

гелей проводили в Кумасси R
-
250
.

37


2.5
.
Очистка

рекомбинантных ингибиторов


Все рекомбинантные белки были клонированы так, что на
N
-

и/или С
-

конце
несли гексагистидиновый таг для очистки
, что позволило использовать для
очистки ингибит
оров н
икель
-
афинную х
роматографию.

Биомассу продуцентов после индукции
получали в виде осадка клеток
центрифугированием культуры

в течение

20
мин при 5
000 ×
g

при температуре


4 °
C
.

З
атем
клетки лизировали в буфере

Л в

течение 30

мин на льду с
последующим разруш
ением клеток ультразвуком при помощи погружного
соникатора.

Клеточный дебрис удаляли из лизатов

центрифугированием в течение
40 мин при 10000 ×
g

при температуре 4 °
C
. Полученные супернатанты
пропускали

через 0
,
2
-
мкм фильтр с ацетат
-
целлюлозной мембраной (
EMD

Millipore
)

и проводили очистку на
Ni
2+
-
агарозной колонке

(
Qiagen
)
. Колонку
промывали

пятикратным объемом буфера

К
. Элюцию ингибиторов

проводили в
буфере Э
. Концентрацию

белка в элюатах опреде
ляли
спектрофо
то
метрически
: по
пог
лощению
на длине волны 280
нм. Коэффициент экстинкции для
рекомбинантных ингибиторов был рассчитан по аминокислотной
последовательности при помощи программы
Vector

NTI
®
Advance

(
Invitrogen
).

Для расчета концентрации использовали формулу

(1)
:


С= А
280
/КЭ,





(1)


где

С



концентраци
я в молях,
А
280



поглощение

на длине волны 280 нм,
КЭ



коэффициент экстинкции; оптический путь 1см.


38


2.6.
Измерение ингибирующей активности


Рекомбинантные ингибиторы перед исследованием

ингибирующей
активности перевели из буфера Э в буфер Х
. Замену буф
ера проводили на 3
-
кДa
центрифужных фильтрах

(
Amicon

Ultra

15 3
kDa
)
, согласно рекомендациям
производителя (
Millipore
)
.

Хромогенные тесты проводили в соответствии с рекомендациями

производителя субстрата (
Chromogenix
, США
) с незначительными

изменениями.
В к
ачестве отрицательного контроля
ингибирования
во всех хромогенных тестах
использовался
рекомбинантный
EGFP

(
Enhanced

Green

Fluorescent

Protein
),
полученный в тех же условиях, что и рекомбинантные ингибиторы (вектор,
штамм
-
продуцент, протокол очистки).

В те
сте ингибирования ф
XIIa

использовался хромогенный субстрат S2302,
в тесте ингибирования ф
XIa

-

S2366,
а в тесте ингибирования трипсина
-

S2765
.

Измерение активности (скорости расщепления

соответствующего

хромогенного субстрата)

в тестах ингибирования

ф
XII
a
, ф
XIa

и трипсина
проводили при 37 °С в буфере
ХТ в 96
-
луночном планшете с плоским дном
(Corning Inc., США). Скорость
расщепления хромогенного субстрата
измеряли на
спектрофотометре

«
Sunrise microplate spectrophotometer» (Tecan Group AG,
Австрия)

на длине

волны 405 нм
.

Конечная концентрация ферментов

в
реакционной смеси
составляла

1 нМ для фXIIa
, 200 пM для фXIa

и

1 нМ для
трипсина, а все хромогенные субстраты использовались в концентрации 500 мкМ.

Эксперименты проводили в трехкратной повторности.

Расчет
констант ингибирования (
Ki
) проводился по остаточной активности
ферментов.

Скорость гидролиза субстрата при 405 нм (
V
) наносили на график
против концентрации ингибитора в обращенных координатах, получая
1/V

(S ×
OD
405
-
1
), которая

зависит от

C

(нМ ил
и мкМ
)
.

Проводили линейную
аппроксимацию и получали

параметры
:

а

-

отрезок, отсекаемый на координатной
оси

ординат
,

и
b



тангенс угла
наклон
а
.

Константы ингибирования вычисляли по
39


формуле
(2)
, представляющую собой
преобразованное

уравнение Михаэлиса
-
Ментена, где

K
m



константа Михаэлиса
(в соответствии с инструкциями
производителя хромогенного субстрата), а
[
S
]



концентрация субстрата в
эксперименте.



(2)


40


2.7.
Подготовка пространственных структур CHFI и его мутантов
для проведения докинга


Для проведения расчетов использовалась кристаллическая структура
CHFI

с
разрешением 1.95

, опубликованная в базе данных Protei
n Data Bank (PDB)
[81]

под номером 1
BEA

[71]
.

При моделирова
нии мутанта CHFI
-
1245

Цис29
был
вручную заменен на Асп.

Для подготовки структуры

CHFI
-
2 (изолированной
протеаза
-
связывающей петли)

аминокислотные остатки за пределами
исследуемого интервала Цис20
-
Цис44 из структуры 1
BEA

были
удалены.
Программ
а
VMD

(
visual

molecular

dynamics
)
[82]

применяла
сь

для

подготовки
модельных систем и дальнейшего анализа молекулярно
-
динамических

(МД)
траекторий
[83]
.

В модель
CHFI
-
12345
были добавлены недостающие атомы
водорода, а также включены молекулы воды, присутствовавшие к
кристаллической структуре 1
BEA
.
Все три модельные структуры (
CHFI

и его
укороченные мутанты) были окр
ужены TIP3P
-
молекулами воды,
образовыва
вшими

куб, грани которого были удалены от исследуемой структуры
не менее, чем на 10

. Также в систему были добавлены ионы натрия и хлора до
конечной концентрации 0,15 М. Расчеты проводились при помощи программного
обе
спечения NAMD 2.9
[84]

с

использованием

силового

поля

CHARMM36
[85]
.
Минимизация энергии атомов водорода,

ионов натрия и хлора и молекул воды,
добавленных в систему
CHFI
-
12345, а также боковые цепи мутированных
аминокислотных остатков
CHFI
-
1245 и
CHFI
-
2 была достигнута за 1000 шагов.
Координаты атомов, описанные в рентгенно
-
структурных данных, были
сохранены.

Полученные структуры были как непосредственно использованы для
проведения докинга с протеазами, так и дополнительно минимизированы методом
молекулярной динамики.

41


2.8
. Молекулярная динамика


Водный куб с подготовленной и оптимизированной системой (для каж
дого
ингиб
итора) был уравновешен в течение

1
-
нс МД
-
симуляции, все координаты
CHFI

были фиксированы (NPT ансамбль, 298 К, 1атм, периодические граничные
условия).
Параметры
модельных систем приведены в таблице (
табл
. 2
).


Таблица
2
.

Основные параметры модельных систем, использованные для
МД
-
симуляции.

Ингибитор

Общее количество
атомов

Количество

молекул
воды

Размер системы

CHFI
-
12345

19090

5782

50.0Å × 61.0Å × 61.3Å

CHFI
-
1245

19613

5805

50.0Å × 61.0Å × 61.4Å

CHFI
-
2

7429

2332

36.4Å

× 44.4Å × 44.7Å


Во время п
ред
варительно
й

подготовки

системы были полностью
энергетически минимизированы за 5000 шагов
. Затем была проведена
50
-
нс МД
-
си
муляция при 298 К с теми же параметрами, которые использовались на этапе
подготовки. Все атомы были п
одвижными.
Полученные 50
-
нс траектории
использовались для анализа конформационных изменений.

Чтобы получить
стабильные конформации мутантов
CHFI

для последующего докинга с
протеазами
, системы, полученные в результате МД
-
симуляции при 298 К
, затем
были медл
енно охлаждены до 4 К при скорости изменения температуры 1 К/нс.

МД
-
симуляции про
водились с использованием супер
компьютера Московского
государственного университета им. М.В. Ломоносова
[86]
.


42


2.9.
Подготовка модельной структуры фактора
XIIa

на основе
гомологии


Поскольку в настоящий момент кристаллическая структура
каталитического домена ф
XIIa

еще не получена, для проведения наших расчетов
была построена модельная структура ф
XIIa

на основании аминок
ислотной
последовательности данного домена (
номер по базе данных
«
UniProt
»

-

P00748).
Поиск г
омологичного бел
к
а

для построения модельной структуры

проводили с
помочью алгоритма
BLAST

[87]

на сервере
«
UniProt
»

[88]
.
Н
аибольшее сходство

среди белков, для которых имеется

опубликованная кристаллическая структура,
было обнаружено с

активатором фактора

роста гепатоцитов

(
номер по базе
данных
«
UniProt
»

-

Q04756)

и составило 47%. Для каталитического домена
данного

белка в баз
е данных
«
PDB
»

доступно несколько структур, лучшая из
которых

(
код в базе данных
«
PDB
»

-

2R0L
) имела разрешение 2,20


[89]
.
Данная
структура и была использована при построении модели ф
XIIa

с помощью
программы «Modeler 9v12»
[90]
.
Валидность полученной модели ф
XIIa

проверяли
докингом трипептида
D
-
Про
-
Фен
-
Арг, аналогичного коммерческому
хромогенному субстрату S2302 (D
-
Про
-
Фен
-
Арг
-
паранитр
о
анилин,
Chromogenix
),
специфическому для данной протеазы. Начальная позиция белка и пептида была

рассчитана при помощи сервера «
ClusPro
»
[91,92]

и

уточнена

с

использованием

«
Rosetta

FlexPepDock
»
[93,94]
.

43


2.10.
Белок
-
белковый

докинг


Докинг
CHFI

и его мутантов с модельной структурой ф
XIIa
, а также с
кристаллическими структурами

трипсина (
номер по базе
данных «
PDB
»
-

2
O
9
Q
,
разрешение 1,70

) и ф
XIa

(номер по базе
данных «
PDB
»
-

3SOR, разрешение 1,70

)

[95]

проводили с использованием веб
-
серверов «ClusPro»
[91,92,96,97]

«
pyDock
»
[98,99]
.
Для

проведения

докинга

при

помощи

сервера

«
pyDock
»,
вводились

ограничения

(
при

взаимодействии
)
Арг
34
ингибитора

и

каталитического

протеаз
.

44


2.11. Статистический анализ


Статистический анализ методом неспаренного
t
-
теста производился в
программе
«
GraphPad

P
rism
»

(
GraphPad

Software
,
США
)
.
Эксперименты
проводились в трехкратной повторности.
Значения р для конкретного случая
приведены на картинках и в тексте
. Различие считалось статистически значимым
при P < 0,05. Представлены усредненные величины ± стандартные

ошибки
среднего, если не указано иное.


45



Глава 3. Результаты


3.1.
Клонирование, экспрессия и очист
к
а

рекомбинантного
CHFI


Для исследования роли различных участков
CHFI
, расположенных вне
ингибирующей петли, во взаимодействии с ф
XIIa

был создан ряд укоро
ченных
мутантов.

Исходя из о
пуб
ликованной
пространственной

структуры

CHFI

(PDB
1BEA)
[71]
, мы создали

5
укороч
енных рекомбинантных вариантов

ингибитора, (а
так же в работе исследован 1 синтетический пептид),

таких
,

что в них
отсутствуют

N
-

и/или С
-
концевые участки и некоторые дисульфидные связи

(рис
.

9
).

В интересах удобства

в

названия
х

рекомб
инантных ингибиторов

отмечены
присутствующие в белке дисульфидные связи (например,

в

CHFI
-
234
сохранены
вторая, третья и четвертая дисульфидные связи).
CHFI
-
12345


это
полноразмерный

рекомбинантный

CHFI

бе
з внесения изменений. В мутанте
CHFI
-
2345
отсутств
уют

11
N
-
концевых аминокислотных

остатков, а также первая
дисульфидная связь; цистеин

55 заменен на аспарагиновую кислоту.
Данный
мутант повторяет опубликованный ранее вариант
CHFI
, за исключением замены
неспаренного цистеина

[58]
.
Мутант CHFI
-
1234 укорочен на 24 аминокислотных
остатка

с С
-
конца
, в нем также разрушена пятая дисульфидная связь;

цистеин 57
заменен на аспарагиновую кислоту.

CHFI
-
234 представляет собо
й комбинацию
первых двух вариантов: мутант
у
корочен на
11
N
-
концевых и 24 С
-
ко
нцевых
аминокислотных остатка, Ц
ис 55 и 57 заменены на аспарагиновую кислоту.

Для
исследования роли участка
CHFI

между третьей

и четвертой дисульфидной
связями, а также наличия
ч
етвертой
дисульфидной связи
, был создан мутант
CHFI
-
123, укороченный с С
-
конца на 34 аминокислотных остатка
. Неспаренные
цистеины 45 и 57
в данном мутанте также заменены на аспарагиновую кислоту.


46




47



Рисунок
9
.
CHFI

и его мутанты. Схемы вторичной структуры.

Позиции
цистеинов подписаны под каждой схемой. Квадратные скобки обозначают
дисульфидные связи, треугольником отмечено положение пеп
тидно
й

связи
Р1
-
Р1’. Замены цистеина на аспарагиновую кислоту отмечены крестиком,
овалом отмечен неспаренный цистеин 86

(А)
. Предполагаемые конформации

CHFI

и его мутантов
. Альфа
-
спирали окрашены красным, дисульфидные
связи


желтым. Ингибирующая петля
повернута вверх. Визуализация
выполнена при помощи программы «Discovery Studio software» (
Accelrys,
Inc., США
)
.


Все рекомбина
нтные белки были клонированы так, что на
N
-

и/или С
-

конце
несли
гексагистидиновый таг для очистки, а также несколько дополнительных
аминокислот

(рис.
1
1
)
.
Этот прием мы использовали для увеличения
рекомбинантных ингибиторов в размере, т.к. известно, что б
елки с молекулярным
весом менее 10 кДа плохо экспрессируются в прокариотических системах

[100]
.

Чтобы исключить вли
я
ние
в
непетельных участков
CHFI

на взаимодействие
его протеаза связывающей петли с ф
XIIa
, был использован синтетический
циклический 25
-
аминокислотный пептид
CHFI
-
2
, представляющий собой
изолированную проте
аза
-
связывающую петлю
. Д
анный пептид содержит
аминокислотные остатки
CHFI

с 20го по 45й

и замыкается в кольцо
дисульфидной связью между цистеинами на его
N
-

и С
-
концах.
Цистеин 29,
который, оставаясь неспаренным, мог бы приводить к образованию дисульфидной
связи между пептидами,
также как и в случае других мутантов заменен на
аспарагиновую кислоту.

В качестве контроля влияния замены цис29 в

изолированной протеаза
-
связывающей петле (
CHFI
-
2
) был использован
рекомбинантный мутант
CHFI
-
1245
, который представляет собой
полноразмерный
C
HFI

с заменой цис29асп.


48



ДНК
-
пос
ледовательности, кодирующие
CHFI
-
12345, CHFI
-
1234, CHFI
-
2345,
CHFI
-
234, CHFI
-
1245, и CHFI
-
123 были
получены методом ПЦР с
и
с
пользование
м

синтетического гена
CHFI

в качестве матрицы
.
При помощи

праймеров (таблица.
1
) в
послед
овательности

были внесены

мутации
(замена
цистеина на
аспарагин
)

в
соответствующих

позициях, а также
добавлены сайте
распознавания для эндо
ну
клеаз рестрикции
Bam
HI и
Hind
III.
В
последовательности мутантов CHFI
-
12345 и CHFI
-
1234 был внесен
дополнительный ст
оп
-
кодон перед сайтом рестрикции
Hind
III, поэтому

в эти два
рекомбинантных ингибитора имеют только
N
-
концевой

гексагистидиновый таг
(рис. 11)
.

Полученные

гены ингибитора и его мутантов были клонированы в
экспрессионный вектор pET28a
. Экспрессионные вектора

трансформировали

в
клетки штамм
-
продуцента
E. coli

Rosetta
-
gami2 DE3.


Рекомбинантный ингибиторы частично экспрессировались в растворимой
форме.

Благодаря наличию гексагистидиновых тагов
на
N
-

и/или С
-
конце белков
,

очищенные
препарат
ы
ингибиторов (рис.
10
)
были получены путем
одностадийной никель
-
афинной хроматографии
.


49





Рисунок
10
. Препараты, очищенных рекомбинантных ингибиторов
(результаты денатурирующего гель
-
элект
р
офореза в

12%

ПААГ
).

М/В


маркер молекулярного веса;
CHFI
-
ER
-

нативный CHFI из зерна

Zea mays);

рекомбинантные ингибиторы: CHFI
-
12345, CHFI
-
1245, CHFI
-
2345, CHFI
-
1234, CHFI
-
234 и CHFI
-
123 (2мкг на дорожку);

EGFP


отрицательный
контроль для тестов ингибирования (10 мкг на дорожку).


Теоретический молекулярный вес рекомбинантных ингибиторо
в вместе с
г
ексагистидиновыми тагами (молекулярный вес N
-

и/или C
-
концевой тагов (а)
составляет 3,8 кДа или 1,5 кДа, соответственно) был рассчитан при помощи
программы
Vector

NTA

и составил 17.5 кДА для CHFI
-
12345, 19 кДА для CHFI
-
1245, 15.2 кДА для CHFI
-
1
234, 18 кДА для CHFI
-
2345, 16 кДА для CHFI
-
234 и
15.5 кДА для CHFI
-
123. Молекулярный вес CHFI дикого типа, рассчитанный тем
же способом, составил 13,6 кДа.

50



Разница в весе CHFI из зерна
Z. mays

и рекомбинантного
CHFI
-
12345
объясняется наличием
N
-
концевого
гексагистидинового тага

(рис
.

11
).




Рисунок
11
. Выравнивание аминокислотных последовательностей
рекомбинантного
CHFI

и его мутантов, построенное при помощи программы
«ClustalW»
[87]
. Цистеины помечены голубыми рамками, мутированные
позиции отмечены красным цветом. Серым выделены таги

для очистки
рекомбинантных ингибиторов. Числа в верхней строке обозначают позиции
цистеинов
, а так же первый и последний аминокислотный остаток
ингибитора (нумерация согласно структуре
CHFI

1
BEA
, опубликованной в
базе данных «
PDB
»).


Приблизительный выхо
д рекомбинантных ингибиторов варьировал между
мутантами от 2,5 до 75 мг очищенного белка на литр культуры.

В качестве
контрольно
го

белка во всех экспериментах по измерению активности
ингибиторов

использовали рекомбинантный EGFP (улучшенный
зеленый
флуоресц
ирующий белок), экспрессированный в тех же условиях (вектор и
штамм
-
продуцент), что и рекомбинантные ингибиторы.

51



3.2. Измерение ингибирующей активности

Для иссле
дования ингибирующей активности рекомбинантного
CHFI

и его
мутантов в отношении ф
XIIa
, ф
XIa

и
трипсина
, очищенные

препараты белка
проверяли в хромогенном тесте
.

При ингибировании

ф
XIIa

отличий между рекомбинантным

полноразмерным
ингибитор
ом

(
CHFI
-
12345)
и
CHFI
, выделенным из кукурузных
зерен не



Рисунок
12
.
Сравнение констант ингибирования (
Ki
) ф
XIIa

рекомбинантного
CHFI

(
CHFI
-
12345) и его укороченных мутантов
. Н/з


различие не значимо.

Изолированная протеаза
-
связывающая петля
CHFI
-
2 не ингибировала ф
XIIa

в хромо
генном тесте.

Положительный контроль
-

полноразмерный
нативный
CHFI
-
ER

из зерна
Zea

m
ays
.


52



выявлено. Этот факт также показывает, что наличие гексагистидинового тага не
влияет на способность ингибитора трипсина из кукурузы
подавлять активность

ф
XIIa

(рис. 12)
.

Мутанты, укороченные на одну дисульфидную связь на
N
-

(CHFI
-
2345) или
С
-
конце (C
HFI
-
1234)
,

ингибировали ф
XIIa

с той же активностью, что и
полноразмерный
CHFI
. Объединение этих двух мутаций (одновременное
укорочение с
N
-

и С
-
конца, мутант
CHFI
-
234) привело к небольшому снижению
ингибирующей активности: Ki = 3.2 ± 0.4 нM при Ki полнораз
мерного ингибитора
равной 1
,
0 ± 0
,
1 нM; уровень значимости р < 0
,
05 (рис.
12
).

Одновременное разрушение четвертой и пятой дисульфидной связи и
удаление соответствующих участков белка у мутанта
CHFI
-
123 приводит к
значительному снижению ингибирующей активн
ости (Ki = 116 ± 16 нM, уровень
значимости р < 0
,
001) по сравнению с диким типом. Мутант
CHFI
-
1245,
представляющий собой полноразмерный
CHFI

с разрушенной третьей
дисульфидной связью также проявлял сниженную ингибирующую активность в
отношении ф
XIIa

(Ki =
50 ± 8
н
M, уровень значимости p < 0.05). Изолированная
протеаза
-
связывающая петля
CHFI

(циклический пептид
CHFI
-
2) не ингибировала
ф
XIIa

в концентрации до 1мМ (рис.
12, табл.

3
). Таким образом, мутанты
сохраняли ингибирующую активность в том случае, если т
ретья и четвертая
дисульфидная связь сохранялись в молекуле. Драматическое снижение
ингибирующей активности наблюдалось уже у
CHFI
-
123.

53




Таблица
3
. Ki фXIIa и трипсина.

Ингибитор

Кi
XIIa,
н
M

Кi т
рипсин
,
н
M

CHFI
-
ER

1
,
0 ± 0
,
1

2
,
1
± 0
,
6

CHFI
-
12345

1
,
1 ± 0
,
2

1
,
3 ± 0
,
2

CHFI
-
2345

1
,
0 ± 0
,
2

2
,
9 ± 0
,
5

CHFI
-
1234

1
,
0 ± 0
,
3

1
,
0 ± 0
,
6

CHFI
-
234

3
,
2 ± 0
,
4

2
,
2 ± 1
,
1

CHFI
-
1245

50 ± 8

250 ± 20

CHFI
-
123

116 ± 16

н
/
о
**

CHFI
-
2

н
/
о
*

11700 ± 1200

*
не определено
:
CHFI
-
2
не ингибировал ф
XII
a

в
концентрации до 1м
M
.


**
не определено:
CHFI
-
1
2
3

не ингибировал
трипсин

в концентрации до
75 мк
M
.




Поскольку изолированная протеаза
-
связывающая петля

CHFI
-
2 не
ингибировал
а

ф
XIIa
,

этот пептид и другие мутанты были также проверены
в
тесте ингибирования тр
ипсина

(
рис. 13, табл. 3
).

Наблюдаемая ингибирующая
активность мутантных была сходной

по порядку величин: от

Ki

= 1
,0

± 0
,
6 нM
(CHFI
-
1234) до

Ki

=

2
,
9 ± 0
,
5 нM (CHFI
-
2345)
,
-

до тех пор, пока в молекуле
ингибитора

сохранялись вторая, третья и чет
вертая дис
ульфидные связи.
CHFI
-
1245 показал значительно пониженную активность в отношении трипсина
(
Ki
=250 ± 70 нM), так же как и

пептид

CHFI
-
2 (
Ki
=12 ± 2
мк
M)
.
CHFI
-
123 не
проявил ингибирующей активности в отношении

трипсина в концентрации

до 75 мк
M
. Поскольку
CH
FI
-
2

частично сохранил ингибирующую активность в
отношении трипсина
, изолированная протеаза
-
связывающая петля
CHFI
,
вероятно, находилась в
функционально
активной конформации.


54




Рисунок
13
. Сравнение констант ингибирования (
Ki
)

трипсина

рекомбинантного
CHF
I

(
CHFI
-
12345) и его укороченных мутантов.

Н/з


различие не значимо.
CHFI
-
123 не ингибировал

ф
XIIa

в хромогенном
тесте.

Положительный контроль

-

полноразмерный

нативны
й

CHFI
-
ER

из
зерна
Zea

mays
.

Чтобы проверить,
как изменилась ингибирующая активность
из
олированной протеаза
-
связывающей петли в отношении протеазы
, которую
CHFI

ингибирует слабо

-

ф
XIa

(
Ki

= 5
,
4 ± 0
,
2
мк
M
)
, был также проведен
тест
ф
XIa
. В к
ачестве контрольного белка для оценки влияния замены Цис29Асп

был
использован мутант
CHFI
-
1245


полнор
азмерный
CHFI

с

разрушенно
й третьей
дисульфидной связью
.
CHFI
-
2
ингибировал ф
XIa

c

Ki
== 94 ± 11
мк
M
. Таким
образом, изолированная протеаза
-
связывающая петля ингибировала

ф
XIa

значительно слабее, по сравнению с полноразмерным белком.
Неожиданно

CHFI
-
1234 не

показал ингибирующей активности в отношении ф
XIa

(рис.
14, табл. 4
).



55




Рисунок
14
.
К
онстант
а

ингибирования (
Ki
) ф
XIa

изо
ли
рованной

про
т
еаза
-
связывающей петлей
CHFI
-
2 в сравнении с мутантом
CHFI
-
1245 (контроль
замены Цис29Арг)

и полноразмерным нативным
C
HFI
-
ER

из зерна
Zea

mays
.


Таблица
4
. Константы ингибирования ф
XIa
.

Ингибитор


К
i
XIa,
мк
M

CHFI
-
ER

5
,
4 ± 0
,
2

CHFI
-
2

94 ± 11

CHFI
-
1245

490 ± 110



56



3.3
.
Моделирование взаимодействия протеаза
-
связывающей петли
CHFI

с ингибируемы
ми протеазами

Для выявления

возможных причин неактивности
CHFI
-
2 в отношении
ф
XIIa
,
к.х.н.

старшим
научным сотрудником Института биохимической физики
им. Н.М. Эмануэля РАН Софьей Владимировной Лущекиной
был
о

проведен
о

м
оделирование взаимодействия

CHFI
-
2, C
HFI
-
1245 и
CHFI
-
12345
(полноразмерный ингибитор
) с ф
XIIa
,

ф
XIa

и трипсином.

Результаты

модельных
экспериментов были опубликованы в совместной статье
(
Korneeva

.
al
., 2014).


За неимением опубликованной
полной
рентгеновской структуры
ф
XIIa
,
была подготовле
на модельная структура данной протеазы, которая и
использовалась в дальнейшем для докинга с
CHFI

и его мутантами.

Структуры
мутантов
CHFI
, использованные в экспериментах были получены из
опубликованной

структуры
CHFI

(1
BEA

в
базе данных «
PDB
»,

[71]
)

методом
молекулярной
динамики

(МД)
.


3.3.1.
Подготовка пространственных структур
CHFI

и его
мутантов для
проведения докинга

Чтобы выяснить и при необходимости учесть конформационные изменен
ия
изолированной протеаза
-
связывающей петли
CHFI
-
2 и
CHFI
-
1245 (
CH
FI

с
замено
й Цис29Асп), были проведены рас
четы молекулярной динамики.
В
результате проведения 50
-
наносекундной симуляции с последующим
охлаждением системы были получены
структуры всех трех ингибиторов,
стабильные в водном окружении.

Положение боковой цепи
Арг34 представляет
особый интерес, т.
к. связь между Арг34 и Лей35 гидролизуется во время
в
заимодействия
CHFI

с протеазой.

Во время
МД
-
симуляции

с
CHFI
-
12345,
CHFI
-
1245 и
CHFI
-
2

не
происходило серьезных конформационных изменений.
Пос
ле охлаждения
системы по
ложение боковой це
п
и

Арг34 в
CHFI
-
12345

отличалось от
состояния в
кристаллической структуре 1
BEA
.
В
CHFI
-
1245 и
CHFI
-
2 Арг
-
34 сходным
57



образом приближен к остову.

Однако, в
CHFI
-
1245 (
мутант с заменой
Цис29Асп)

Арг34 формирует стабильный солевой мостик с Ас
п29 (рис.
15 А
), что несколько
изменяет форму
протеаза
-
связывающей петли (рис.
1
5

Б
).
В
CHFI
-
2 угол

между
двумя альфа
-
спиралями несколько отличался от угла между
соответствующими

спиралями в исходной рентгеновской структуре
CHFI

(рис.
1
5

В
). Данное
изменен
ие конформации привело к тому, что
изолированная протеаза
-
связывающая петля имела более жесткую конформацию по сравнению с
петлей
,
находящейся в составе ингибитора. Арг34 и Асп29

при этом находились в
пептиде на расстоянии 7

, что не позволяло им сформиро
вать солевой мостик.





Рисунок
15
.
Конформация протеаза
-
связывающей петли
CHFI
, нативной и
мутированной (с заменой

Цис 29 Арг). А и Б


конформация петли
CHFI
-
1245
с заменой

Цис 29 Асп

(результат МД
-
симуляции).
А


мутированная
протеаза
-
связывающая петл
я
CHFI
-
1245 с заменой Цис 29 Арг.
Солевой
мостик между Арг34

(
R
34)

и
Асп29

(
D
29)

(А) показан точечной линией
.
Боковые цепи Арг34 (
R
34), Асп29 (
D
29) и неспаренным Цис29 (С29)
показаны шариками и палочками.
Б
-

н
аложение протеаза
-
связывающих
петель нативного

CHFI

(
CHFI
-
12345
, синего цвета
)

и мутантной у
CHFI
-
1245
(
красная) по результатам МД
-
симуляции.
В


у
гол между альфа
-
спиралями
ок
а
зался несколько различным у пептида
CHFI
-
2
(синий)
и нативного
CHFI
-
12345

(красный)
по
результатам МД
-
симуляции. Визуализация
структур
выполнена при помощи плагина «
Bendix
»
[101]

для программы «
VMD
».


58



Так как между известной рентгеновской структурой
CHFI

и
структурой

после оптимизации
, проведенной методом МД наблюдались различия в
положении Арг34, дл
я дальнейших экспериментов (доки
нг) использовались оба
варианта структуры для кажд
ого из ингибиторов
: рентгеновская структура после
минимизации мутированных участков и стабилизированные в водной среде

и

структуры после 50 нс МД при 298 К и
медленного охлаждения системы до 4 К.


59



3.3.2
.
Моделирование структуры ф
XIIa
.
Докинг


Модельная ст
руктура ф
XIIa

построенная

на основе гомологии с
каталитической триадой серин
-
гистидин
-
аспарагиновая кислота
, расположенной в
щели на поверхности
фермента и находящейся в положении, позволяющем
производить каталитической расщепление субстрата представлена н
а рисунке
16

(рис.
16 А
).


Оценку пригодности

модельной структуры ф
XIIa

проводили путем докинга
с трипептидом, аналогичным

специфическому коммерческому хромогенному
субстрату
S
2302 (
H
-
D
-
пропил
-
L
-
фенилаланил
-
L
-
аргинин
-
паранитроанилина
гидрохлорид). Позиция
пептида, рассчитанная при помощи веб
-
сервера
«
ClusPro
», была использована в качестве стартовой точки для более точного
моделирования при помощи веб
-
сервера «
Rosetta

FlexPepDock
»
[93,94]
. Для
повышения точности расчетов пептид считался гибким. По результатам расчетов
трипептид был локализован в активном сайте ф
XIIa

(рис.

16 Б
), так что
расщепляемая пептидная связь находилась между фенилаланином и аргинином
протеазы. Положение трипептида д
ополнительно стабилизировалось
взаимодействием между аргинином субстрата и остатком Асп141 фактора
XIIa
.
Таким образом, полученная модельная структура была признана годной для
проведения дальнейших экспериментов.

60




Рисунок
16
.

Модельная структура ф
XIIa
. А
-

м
одельная

структура

ф
XIIa
,
боковые цепи аминокислотных остатков каталитической триады показаны
шариками и палочками и подписаны, альфа
-
спирали окрашены красным, а
бета
-
слои


голубым цветом.

Б. Результаты докинга трипептида Про
-
Фен
-

Арг (аналог хромошенн
ого субстрата
S
2302, который использовался в
экспериментах)
. Пептид
(сине
-
голубой)
находится в активном сайте
протеазы. Ф
XIIa

(серый). Боковые цепи аминокислотных остатков
61



каталитической триады ф
XIIa

показаны шариками и палочками и
подписаны
.


В большинств
е случаев, наиболее выгодное значение энергетической
функции для комплекса протеаза
-
ингибитор было получено

при использовании
структур
CHFI

и его мутантов

(
CHFI
-
1245 и
CHFI
-
2)
, оптимизированных методом
молекулярной динамики

(табл.
5
)
.

Э
то позволяет предпол
ожить, что конформации
ингибиторов, полученные в ходе МД
-
симуляции лучше подходят для
ингибирования целевых протеаз, чем минимизированные кристаллические
структуры.

Результаты докинга оптимизированных структур ингибиторов с протеазами не
противоречили эксп
ериментальным данным. Как
CHFI
, так и мутанты
CHFI
-
2 и
CHFI
-
1245 связывались с активным сайтом трипсина в позиции, пригодной для
расщепления связи между Арг34 и Лей35 ингибитора

(рис. 17)
, однако пептид
CHFI
-
2 связывался слабее по сравнению с
CHFI

и мутант
ом
CHFI
-
1245.
Это
согласовывалось с экспериментальными данными, полученн
ыми в хромогенном
тесте (табл. 3
, рис.
13)
.



62




Таблица
5
.
Белок
-
белковый докинг CHFI и его мутантов с трипсином, фXIa и
фXIIa, выполненный при помощи сервера

«pyDock».


Ингибитор

Трипсин

ФXIa

ФXIIa

Энергетич
еская
функция

Позиция
ингибитора

Энергети
ческая
функция

Позиция
ингибитора

Энергетич
еская
функция

Позиция
ингибитора

CHFI
-
12345

Кристалличе
ская

-
111,794

Вблизи
активного сайта;
каталитическая
триада откр
ыта

-
111,343

Вблизи
активного
сайта;
каталитическая
триада открыта


-
115,585

Вблизи активного
сайта; каталитическая
триада открыта

Результат
МД
-
симуляци
и

-
121,355

Водородные
связи с
каталитической
триадой

-
102,767

Арг34 в

активном сайте
вблизи Асп480



-
126,167

Арг34 в активном
сайте протеазы

CHFI
-
1245
(Цис29Асп)

Кристал
-
лическая

М
инимиз
ированная

-
109
,
923

Вблизи
активного сайта;
каталитическая
триада открыта

-
117,278

Арг34 в
активном
сайте
протеазы

-
117,116

Вблизи активного
сайта; каталитическая
триа
да открыт
а

А

Результат
МД
-
симуляции

-
119
,
760

Арг34 в активном
сайте протеазы

-
114,151

Далеко от
активного сайта





-
120,005

Арг34 в активном
сайте протеазы

CHFI
-
2

Кристал
-
лическая

М
инимизиро
ванная

-
113,482

Вблизи
активного сайта;
каталитическая
триада

открыта

-
113,956

Вблизи
активного
сайта;
каталитическая
триада открыта

-
122,335

Вблизи активного
сайта; каталитическая
триада открыта




Результат
МД
-
симуляци
и

-
112,049

Арг34 в активном
сайте протеазы

-
114,054

Арг34 в
активном сайте
протеазы

-
131,186

Д
алеко от активного
сайта


63





Рисунок
17
. Комплексы трипсина с ингибиторами, полученные в результате
белок
-
белкового докинга.
А
-

комплекс с
CHFI
-
12345;
Б
-

комплекс с
CHFI
-
2;
В
-

комплекс с
CHFI
-
1245.
Структуры ингибиторов получены в результате
МД
-
симуля
ции. Взаимодействующие боковые цепи аминокислотных
остатков трипсина (зеленый) и ингибиторов (голубые) показаны шариками
и палочками.

При моделировании

взаимодействия
CHFI

с ф
XIa

Арг
34 ингибитора также
оказался в активном сайте протеазы, но

сравнительно д
алеко от каталити
ческого
серина.

Кроме того, значение энергетической функции было также
ниже, по
сравнению со значениями, полученными для комплекса
CHFI
-
трипсин.

Этим,
вероятно, может объясняться увеличение константы ингибирования фактора
XIa

С
HFI

(5.4 ± 0
.2 мкМ)
на три порядка, по сравнению с
Ki

трипсина

(1.3 ± 0.2 нМ)
.


В случае взаимодействия
CHFI
-
1245 с ф
XIa

рассчитанное положение

ингибитора было
далеко от активного сайта протеа
зы и дополнительно
64



стабилизировалось солевыми мостиками (рис.
18 Б
).

Существ
ование
альтернативного сайта связывания
CHFI
-
1245 на поверхности ф
XIa

может
служить объяснением отсутствия ингибирующей активности
CHFI
-
1245 в
отношении ф
XIa

в хромогенном тесте (т
абл. 4
, рис.
14
).

Взаимодействие изолированной протеаза
-
связывающей петли (п
ептид
CHFI
-
2)
c

ф
XIa

было сходным со случаем взаимодействия с трипсином. Пептид
занял позицию в активном сайте фактора

(рис.
18 В
)
.

Комплексы
CHFI
-
ф
XIIa

и
CHFI
-
1245 (мутант с заменой Цис29Асп)
-
ф
XIIa

также
были сходными с их комплексами с трипсином

(рис. 18
Г, Д)
: протеаза
связывающая петля ингибиторов оказывалась в каталитическом сайте ф
XIIa
.

При
моделировании комплекса

CHFI
-
2
-
ф
XIIa

позиция пептида была вне активного
сайта

фактора и была стабилизирована гидрофобными взаимодействиями


(рис.
18 Е
)
.



65




Рисунок

18
.
Комплексы ф
XIa

(А, Б и В) и ф
XIIa

(
Г, Д и Е)

с ингибиторами

(
CHFI
-
12345


А, Г
;
CHFI
-
1245


Б, Д;
CHFI
-
2


В, Е)
, полученные в
результате белок
-
белкового докинга. Структуры ингибиторов получены в
результате МД
-
симуляции. Взаимодействующие боковые цепи

66



аминокислотных остатков трипсина (зеленый) и ингибиторов (голубые)
показаны шариками и палочками
.

67



Глава 4. Обсуждение

В данной работе мы показали, что
при образ
овании ком
плекса
CHFI
-
ф
XIIa

взаимодействия

между участками белков, не относящимися к протеаза
-
связывающей петле и
каталитическому центру, возможно
, вносят вклад в
специфичность и силу связывания.
Таким образом,
CHFI
, вероятно, первый
ка
нонический ингибитор, протеаза
-
связывающей петли которого не достаточно
для ингибирования
целевой протеазы: по на
шим данным,
циклический пептид
CHFI
-
2 не проявляет ингибирующей активности в отношении ф
XIIa
. Более того,
результаты докинга
CHFI
-
2 и ф
XIIa

показали, что пептид, вероятно
, связывается
не с активным сайтом протеазы. Это неожиданный результат для

каноническо
го
ингибитора, т.к. известно, что изолированные протеаза
-
связывающие петли таких
ингибиторов

действуют как независимые структурные элементы


и
обуславливают взаимодействие с ингибируемой протеазой.

Например,
циклический пептид, представляющий собой изолиро
ванную протеаза
-
связывающую петлю
SFTI
-
1 не только сохраняет ингибирующую активность

в
отношении трипсина (
Ki
=0,5 нМ), но и превосходит по
активности
полноразмерный ингибитор (
Ki
=19 нМ)
[102]
.

CHFI
-
2

(изолированная протеаза
-
связывающая петля
CHFI
)

богата
пролином
и, поэтому обладает жесткой конформацией.
Нашей начальной
гипотезой
было то, что несмотря на наличие

трех
пролинов, изолированная петля

могла бы оказаться излишне гибкой, по сравнению с
соотв
етствующим

участком
полноразмерного ингибитора.

Подобная
конформационная подвижность могла бы
отразиться на взаимодействии

с ф
XIIa

(более тесном, т.к.
Ki
=1,1 ± 0,2 нМ)

и,
предположительно, должна была бы меньше повлиять на слабое взаимодействие с
ф
XIa

(5,4

± 0,2 мкМ)
. Поэтому нами
б
ыла проверена ингибирующая активность
CHFI
-
2 в отношении протеаз, которые специфически ингибируются
CHFI

(трипсин и ф
XIIa
) и ф
XIa
,

ингибирующая активность в отношении которого
значительно ниже. Для предсказания характера взаимоде
йствия

CHFI
-
2 с этими
протеазами

были использованы вычислительные методы: МД и докинг.

68



По результатам МД
-
симуляции наша гипотеза об излишней гибкости
изолированной

протеаза
-
связывающей петли не подтвердилась
, напротив, по
расчетам, структура пептида должна

быть жесткой

и не имеет серьезных отличий
от петли в нативном ингибиторе. Единственным
небольшим изменением
, по
результатам МД расчетов,
было
небольшое изменение угла между
альфа
-
спиралями, фланкирующими

петлю, по сравнению с положением
соответствующих сп
иралей в полноразмерном
CHFI

(
рис.

1
5

В
).

Таким образом,
результаты расчетов не подтвердили нашу гипотезу об избыточной гибкости

изолированной протеаза
-
связывающей петли.

Результаты измерения ингибирующей активности пептида
CHFI
-
2
согласуются с литературны
ми данными об изолированных протеаза
-
связывающих
петлях канонических ингибиторов
[102,103]
. Наши экспериментальные данные

позволяют заключить, что изолированная протеаза
-
связывающая петля
CHFI

частично сохраняет ингибирующую активность

и может действовать как
независимый структурный элемент.
CHFI
-
2
сохраняет

ингибирующую активность
в отношении

ф
XIa
, хотя константа ингибирования

(
94 ± 11 мкМ)

и
возросла,
примерно, в 20 раз, по сравнению с по
лноразмерным
CHFI

(
Ki
=
5,4 ± 0,2 мкМ)
.
CHFI
-
2 также
сохранил способность ингибировать трипсин, однако различие в
константах ингибирования изолированной петли и полноразмерного ингибитора
оказалось даже выше, чем в случае ф
XIa

(
12 ± 2 мкM и 1,3 ± 0,2 нM,
соо
тветственно).

Если рассмотреть экспериментальные данные и результаты МД
-
симуляции

в комплексе, по можно предположить, что изолированная протеаза
-
связывающая петля
находилась

в активной конформации
, т.к.
CHFI
-
2
ингибировал трипсин и ф
XIa

в хромогенном тесте
. Р
езультаты докинга
согласуются с

экспериментальными данными , поскольку расщепляемая
пептидная связь (между Арг34 и Лей35) находилась в каталитическом сайте
как
при взаимодействии с трипсином, так и с ф
XIa
.

Неожиданным результатом явилось то, что
CHFI
-
2
не ингибировал ф
XIIa

в
хромогенном тесте
. Поскольку пептид, предположительно, находился в активной
69



конформации
, отсутствие ингибирования

может объясняться некорректным
положением расщепляемой пептидной связи протеаза
-
связывающей петли
относительно активног
о сайта ф
XIIa
.

Мы предполагаем, что корректное
положение протеаза
-
связывающей петли
CHFI

в щели активного
сайта

ф
XIIa

обеспечивается взаимодействиями непетельных участков ингибитора с ф
XIIa

за
пределами его активного сайта. С данной гипотезой согласуются с

результатами
докинга
CHFI
-
2 и ф
XIIa
. Наиболее энергетически выгодная позиция пептида
находилась вне активного

сайта модельной структуры

ф
XIIa

(рис.
18 Е
).

Однако, с
другой стороны
,

непропорциональная потеря ингибирующей активности
изолированной протеаза
-
с
вязывающей петли

в отношении ф
XIIa

по сравнению с
трипсином и ф
XIa

может также частично обуславливаться

заменой Цис29 на Асп
,
а также отсутствием стабилизации за счет взаимодействия петли с другими
частями ингибитора.

Для прояснения возможных причин

отсутс
твия
ингибирующей
активности

CHFI
-
2 в отношении ф
XIIa
, вклад стабилизации протеаза
-
связывающей петли
CHFI

за счет третьей дисульфидной связи был исследован
экспериментально в
хромогенных тестах активности ф
XIIa
, ф
XIa

и трипсина

в присутствии мутанта
CHFI
-
1
245 (полноразмерный ингибитор с заменой Цис29Асп

и, как следствие,
разрушенной третьей дисульфидной связью
).

Данный мутант также является
контролем для замены Цис29Асп в пептиде
CHFI
-
2.
CHFI
-
1245

показал
сниженную способность ингибировать

ф
XIIa

и трипсин (
Ki = 50 ± 8 и


250 ± 20 нM,
соответственно
) по сравнению
с полноразмерным ингибитором (Ki
= 1,0 ± 0,1 и 1,3 ± 0,2 нM, соответственно).

Неожиданным результатом стало то,
что

CHFI
-
1245 практически не ингибировал ф
XIa

(Ki = 490 ± 110 мкМ).
Результаты докинга
позволяют объяснить это наличием

альтернативного (вне
каталитического сайта)

сайта связывания
CHFI
-
1245на поверхности ф
XIa


(рис.
18 Б
).

Тем не менее,
сох
раняющаяся
пониженная
ингибирующая активность
CHFI
-
1245 в отношении ф
XIIa

и трипсина позволяет предпол
ожить, что
стабилизация протеаза
-
связывающей петли за

счет третьей дисульфидной связи
70



вносит вклад во взаимодействие
CHFI

с активным сайтом ф
XIIa
, но в то же время
замена Цис29Асп не может расцениваться как единственная причина потери
ингибирующей активнос
ти
CHFI
-
2
в отношении ф
XIIa
.

Д
анные

ферментативной кинетики

позволяют предположить, что
либо
участок
CHFI

между Гли39 и
Тре108 участвует во взаимодействии с ф
XIIa
, либо
четвертая дисульфидная связь важна для формирования третичной структуры
CHFI
.
Разрушени
е первой и пятой дисульфидной связи (и удаление
соо
тветствующих участков белка
) не

влияет на взаимодействие укороченного
ингибитора с ф
XIIa
.

Использ
уя

конформационный подход к изучению связи структуры
и
н
гибитора и его ингибирующей активности
[104]
,

а также

данные о

сохранении
ингибирующей активности у

ранее описанный мутант
е
CHFI
, укороченном на 11
аминокислотных остатков с
N
-
конца

[58]
, мы создали и исследовали
ингибирующую активность четырех укороченных мутантов
CHFI

в сравнении с
ингибитором дикого типа.

Укороченные мутанты
CHFI
-
1234 (
Ki

= 1
,
0 ± 0
,
3 нМ в
отношении
FXIIa
) и
CHFI
-
2345 (
Ki

= 1
,
0 ± 0
,
2 нМ
)
сохраняют ингибирующую
активност
ь

на уровне полноразмерного
CHFI

(
Ki

= 1
,
0 ± 0
,
1
нМ
);
что согласуется
с данными о первом укороченном мутанте
CHFI

[58]
.

Мутант
CHFI
-
234
представляет собой объединений изменений, внесенных в
CHFI
-
1234
и

CHFI
-
2345
. Данный мутант имеет константу ингибирования ф
XIIa

3
,
2 ± 0
,
4 нМ, что
статистически не значимо отличается от
Ki

CHFI
-
1234,
CHFI
-
12345 и
CHFI
-
2345
при уровне значимос
ти р<

0
,
01(
p

= 0
,
0013; рис
.
1
2)
.

Сходные
результаты были получены для этого мутанта и в хромогенном тесте
ингибирования

трипсина
(
т
абл. 3

и

рис
.
1
3).
Взятые вместе эти данные позволяют
заключить, что
первые 11
N
-
концевые и 24 последние С
-
концевые

аминокисл
отные остатки
CHFI
, а также первая и пятая дисульфидные связи не
участвуют во взаимодействии с ф
XIIa

и трипсином.

Следовательно,
CHFI
-
234


это минимальный фрагмент
CHFI
, сохраняющий ингибирующую активность

в
71



отношении ф
XIIa
, а
CHFI
-
2 может действовать как

независимы
й

структурный
элемент
, способный ингибировать

трипсин и ф
XIa
.

Технической, но
,

тем не менее
,

критически важной частью данного исследования

было

получить функционально активный рекомбинатный
CHFI

и его мутантные
варианты в
E
.
coli
.

Описанные в ли
тературе подходы к получению
рекомбинантного
CHFI

в прокариотической экспрессионной системе (
E
.
coli
)
не
позволяли получать функционально активный ингибитор, т.к.
ходе экспрессии
формировались тельца включения
[58,105]
.

Т.к.
CHFI

содержит пять
дисульфидных связей

[71]
, для его корректного фолдинга требуется

окислительная среда

[106]
, в то время как в цитоплазме
E
.
coli

среда
восстановительная

[107]
.

Традиционно используемые экспрессионные штаммы
E
.
coli
, например,

BL
21
DE
3, которые ранее был использован для получения
рекомб
и
нантного
CHFI

[58,105]

не обеспечивают оптимальных условий для
формирования дисульфидных связей вследствие работы системы поддержания
клеточного редокс
-
гомеостаз
а тиоредоксинами
[107]
.
Чтобы преодолеть данное
ограничение для экспрес
с
ии
CHFI

и его мутантов нами был выбран штамм
-
продуцент
E
.
coli

Rosetta
-
gami

2
DE
3, с измененной активностью тиоредоксин
-

и
глюторедоксин
-
зависимых систем поддержания ре
д
окс
-
гомеостаза
[108]
.

Таким
образом, растворимая экспрессия
CHFI

и его мутантов, которой нам удалось
добиться в экспериментах согласуется с литературными данными о
применимости штамма
E
.
coli

Rosetta
-
gami

2
DE
3
[109]
.

Подводя итог

обсуждения наших результатов
, мы приходим к следующему.
Взаимодействия
вне активного сайта ф
XIIa

и протеаза
-
связывающей петли
CHFI

вносят вклад в силу и специфичность

связывания, поскольку изолированная
протеаза
-
связывающая петля не ингибируе
т ф
XIIa
, но сохраняет частичную
активность в отношении других протеаз, таких как ф
XIa

и трипсин.

Полученные
данные позволяют предположить, что

ингибирования фактора
XIIa

CHFI

происходит по стандартному механизму

[10]
,

но с обязательным участием
некоторых участков
CHFI

вне протеаза
-
связывающей петли.

Однако
с трипсином
72



и ф
XIa

CHFI

взаимодействует по стандартному механизму, в которо
м протеаза
-
связывающая петля

играет ключевую роль.


73



Выводы


1.

Разработанный нами протокол экспрессии CHFI и его мутантов в E. coli
штамм Rosetta
-
gami 2 DE3 при температуре 25 °С позволяет получить
данный рекомбинантный ингибитор в частично растворимой,
функ
ционально активной форме и выделить после однофазной очистки
препараты белков с чистотой выше 99% по электрофорезу в
полиакриламидном геле.

2.

Изолированная протеаза
-
связывающая петля CHFI действует как
независимый структурный элемент и ингибирует сериновые п
ротеазы
трипсин и фXIa. Минимальный фрагмент CHFI, сохраняющий
ингибирующую активность в отношении фXIIa, образован
аминокислотными остатками 12
-
108 (1BEA, PDB).

3.

Протеаза
-
связывающая петля CHFI принимает участие во взаимодействии с
сериновыми протеазами,
но не обуславливает ингибирующую активность
CHFI в отношении фXIIa.

74



Благодарности


Я глубоко признательна моему научному руководителю Михаилу
Александровичу Пантелееву и директору

Центра теоретических проблем физико
-
химической фармакологии РАН Фазоилу Ин
оятовичу Атауллаханову, а также д.
б.н. Владимиру Глебовичу Лунину за любезно предоставленную плазмиду с
последовательностью гена
CHFI
, а так же Алене Викторовне Коршуновой и
коллективам лабораторий физической биохимии крови Гематологического
научного цент
ра, биофизики и клеточного гемостаза и тромбоза Федерального
научно
-
клинического центра
детской гематологии, онкологии и иммунологии
имени Дмитрия Рогачева за всестороннюю методическую поддержку.


75



Список литературы


1.

Tripathi L.P., Sowdhamini R. Genome
-
wide survey of prokaryotic serine
proteases: analysis of distribution and domain architectures of five serine protease
families in prokaryotes. // BMC Genomics. 2008. Vol. 9. P. 549.

2.

Smith S.A. et al. Polyp
h
osphate modulates blood coagulation and fibrinolysis. //
Proc. Natl. Acad. Sci. U. S. A. 2006. Vol. 103, № 4. P. 903

908.

3.

Kannemeier C. et al. Extracellular RNA constitutes a natural procoagulant
cofactor in blood coagulation. // Proc. Natl. Acad. Sci.
U. S. A. 2007. Vol. 104, №
15. P. 6388

6393.

4.

Renné T. The procoagulant and proinflammatory plasma contact system. // Semin.
Immunopathol. 2012. Vol. 34, № 1. P. 31

41.

5.

Nossel H.L. et al. Inhibition of Hageman factor activation. // J. Clin. Invest. 19
68.
Vol. 47, № 5. P. 1172

1180.

6.

Hsu L.C. Heparin
-
coated cardiopulmonary bypass circuits: current status. //
Perfusion. 2001. Vol. 16, № 5. P. 417

428.

7.

Renné T. et al. Defective thrombus formation in mice lacking coagulation factor
XII. // J. Exp. Med
. 2005. Vol. 202, № 2. P. 271

281.

8.

Yau J.W. et al. Selective depletion of factor XI or factor XII with antisense
oligonucleotides attenuates catheter thrombosis in rabbits. // Blood. 2014.

9.

Leung P.Y. et al. Inhibition of Factor XII
-
Mediated Activatio
n of Factor XI
Provides Protection Against Experimental Acute Ischemic Stroke in Mice. //
Transl. Stroke Res. 2012. Vol. 3, № 3. P. 381

389.

10.

Laskowski


Jr. M., Kato I. Protein inhibitors of proteinases // Annu Rev Biochem.
1980/01/01 ed. 1980. Vol. 49.

P. 593

626.

11.

Schechter I., Berger A. On the size of the active site in proteases. I. Papain //
Biochem. Biophys. Res. Commun. 1967. Vol. 27, № 2. P. 157

162.

12.

Farady C.J., Craik C.S. Mechanisms of macromolecular protease inhibitors. //
Chembiochem.
2010. Vol. 11, № 17. P. 2341

2346.

76



13.

Zakharova E., Horvath M.P., Goldenberg D.P. Structure of a serine protease
poised to resynthesize a peptide bond. // Proc. Natl. Acad. Sci. U. S. A. 2009. Vol.
106, № 27. P. 11034

11039.

14.

Dodson G. Catalytic triads

and their relatives // Trends Biochem. Sci. 1998. Vol.
23, № 9. P. 347

352.

15.

Frey P., Whitt S., Tobin J. A low
-
barrier hydrogen bond in the catalytic triad of
serine proteases // Science (80
-
. ). 1994. Vol. 264, № 5167. P. 1927

1930.

16.

Warshel A., Pa
pazyan A. Energy considerations show that low
-
barrier hydrogen
bonds do not offer a catalytic advantage over ordinary hydrogen bonds. // Proc.
Natl. Acad. Sci. U. S. A. 1996. Vol. 93, № 24. P. 13665

13670.

17.

Ratnoff O.D., Davie E.W., Mallett D.L. Studies

on the action of Hageman factor:
evidence that activated Hageman factor in turn activates plasma thromboplastin
antecedent. // J. Clin. Invest. 1961. Vol. 40, № 15. P. 803

819.

18.

Fuhrer G. et al. FXII. // Blut. 1990. Vol. 61, № 5. P. 258

266.

19.

Mutch
N.J., Waters E.K., Morrissey J.H. Immobilized transition metal ions
stimulate contact activation and drive factor XII
-
mediated coagulation. // J.
Thromb. Haemost. 2012. Vol. 10, № 10. P. 2108

2115.

20.

Vanwildemeersch M. et al. The anti
-
angiogenic His/Pro
-
rich fragment of
histidine
-
rich glycoprotein binds to endothelial cell heparan sulfate in a Zn2+
-
dependent manner. // J. Biol. Chem. 2006. Vol. 281, № 15. P. 10298

10304.

21.

McMullen B.A., Fujikawa K. Amino acid sequence of the heavy chain of human
alpha
-
factor XIIa (activated Hageman factor). // J. Biol. Chem. 1985. Vol. 260, №
9. P. 5328

5341.

22.

Ratnoff O.D. Studies on the inhibition of ellagic acid
-
activated Hageman factor
(factor XII) and Hageman factor fragments. // Blood. 1981. Vol. 57, № 1. P. 55

58.

23.

De Agostini A. et al. Inactivation of factor XII active fragment in normal plasma.
Predominant role of C
-
1
-
inhibitor. // J. Clin. Invest. 1984. Vol. 73, № 6. P. 1542

1549.

24.

Akiyama H. et al. Mechanism of activation of coagulation factor XI by fa
ctor XIIa
studied with monoclonal antibodies. // J. Clin. Invest. 1986. Vol. 78, № 6. P.
1631

1637.

77



25.

Di Scipio R.G., Kurachi K., Davie E.W. Activation of human factor IX (Christmas
factor). // J. Clin. Invest. 1978. Vol. 61, № 6. P. 1528

1538.

26.

Muszb
ek L. et al. Factor XIII: a coagulation factor with multiple plasmatic and
cellular functions. // Physiol. Rev. 2011. Vol. 91, № 3. P. 931

972.

27.

Hoffman M., Monroe D.M. A cell
-
based model of hemostasis. // Thromb.
Haemost. 2001. Vol. 85, № 6. P. 958

965
.

28.

Davie E.W., Fujikawa K. Basic mechanisms in blood coagulation. // Annu. Rev.
Biochem. 1975. Vol. 44. P. 799

829.

29.

Anisuzzaman et al. Longistatin, a plasminogen activator, is key to the availability
of blood
-
meals for ixodid ticks. // PLoS Pathog.
2011. Vol. 7, № 3. P. e1001312.

30.

Stormorken H., Gjoennaess H., Laake K. Interrelations between the clotting and
kinin systems. Activation of factor VII involving prekallikrein
-
kallikrein. A
review. // Haemostasis. 1973. Vol. 2, № 6. P. 245

252.

31.

Suon
taka A.M. et al. Occurrence of cold activation of transfusion plasma during
storage at +4 degrees C. // Vox Sang. 2005. Vol. 88, № 3. P. 172

180.

32.

Konings J. et al. Factor XIIa regulates the structure of the fibrin clot independently
of thrombin generat
ion through direct interaction with fibrin. // Blood. 2011. Vol.
118, № 14. P. 3942

3951.

33.

Ichinose A., Fujikawa K., Suyama T. The Activation of Pro
-
urokinase by Plasma
Kallikrein and Its Inactivation by Thrombin // J. Biol. Chem. 1986. Vol. 261. P.
348
6

3489.

34.

Ratnoff O.D., Colopy J.E. A familial hemorrhagic trait associated with a
deficiency of a clot
-
promoting fraction of plasma. // J. Clin. Invest. 1955. Vol. 34,
№ 4. P. 602

613.

35.

Lämmle B. et al. Thromboembolism and bleeding tendency in congen
ital factor
XII deficiency
--
a study on 74 subjects from 14 Swiss families. // Thromb.
Haemost. 1991. Vol. 65, № 2. P. 117

121.

36.

Wagenaar
-
Bos I.G. a, Hack C.E. Structure and function of C1
-
inhibitor. //
Immunol. Allergy Clin. North Am. 2006. Vol. 26, № 4
. P. 615

632.

37.

Pixley R. a, Schapira M., Colman R.W. The regulation of human factor XIIa by
plasma proteinase inhibitors. // J. Biol. Chem. 1985. Vol. 260, № 3. P. 1723

1729.

78



38.

Vestergaard A.B. et al. Histidine
-
rich glycoprotein inhibits contact activ
ation of
blood coagulation. // Thromb. Res. 1990. Vol. 60, № 5. P. 385

396.

39.

MacQuarrie J.L. et al. Histidine
-
rich glycoprotein binds factor XIIa with high
affinity and inhibits contact
-
initiated coagulation. // Blood. 2011. Vol. 117, № 15.
P. 4134

4141
.

40.

Rawlings N.D., Barrett A.J., Bateman A. MEROPS: the database of proteolytic
enzymes, their substrates and inhibitors. // Nucleic Acids Res. 2012. Vol. 40, №
Database issue. P. D343

D350.

41.

Huntington J. a, Read R.J., Carrell R.W. Structure of a ser
pin
-
protease complex
shows inhibition by deformation. // Nature. 2000. Vol. 407, № 6806. P. 923

926.

42.

Sanchez J. et al. Control of contact activation on end
-
point immobilized heparin:
the role of antithrombin and the specific antithrombin
-
binding sequen
ce. // J.
Biomed. Mater. Res. 1995. Vol. 29, № 5. P. 655

661.

43.

Sanchez J. et al. Studies of adsorption, activation, and inhibition of factor XII on
immobilized heparin. // Thromb. Res. 1998. Vol. 89, № 1. P. 41

50.

44.

Bäck J. et al. Distinctive regulat
ion of contact activation by antithrombin and C1
-
inhibitor on activated platelets and material surfaces. // Biomaterials. 2009. Vol.
30, № 34. P. 6573

6580.

45.

Schousboe I. Binding of activated Factor XII to endothelial cells affects its
inactivation by t
he C1
-
esterase inhibitor. // Eur. J. Biochem. 2003. Vol. 270, № 1.
P. 111

118.

46.

Simantov R. et al. Histidine
-
rich glycoprotein inhibits the antiangiogenic effect of
thrombospondin
-
1. // J. Clin. Invest. 2001. Vol. 107, № 1. P. 45

52.

47.

Rawlings N.D.,
Barrett A.J., Bateman A. MEROPS: the database of proteolytic
enzymes, their substrates and inhibitors // Nucleic Acids Res. 2011/11/17 ed.
2012. Vol. 40, № Database issue. P. D343

D350.

48.

Cheng Q. The Group B Streptococcal C5a Peptidase Is Both a Specifi
c Protease
and an Invasin // Infect. Immun. 2002. Vol. 70, № 5. P. 2408

2413.

49.

Makinoshima H., Glickman M.S. Site
-
2 proteases in prokaryotes: regulated
intramembrane proteolysis expands to microbial pathogenesis. // Microbes Infect.
2006. Vol. 8, № 7. P
. 1882

1888.

79



50.

Carruthers V.B., Blackman M.J. A new release on life: emerging concepts in
proteolysis and parasite invasion. // Mol. Microbiol. 2005. Vol. 55, № 6. P. 1617

1630.

51.

Krishnamoorthi R., Gong Y.X., Richardson M. A new protein inhibitor of t
rypsin
and activated Hageman factor from pumpkin (Cucurbita maxima) seeds. // FEBS
Lett. 1990. Vol. 273, № 1
-
2. P. 163

167.

52.

Campos I.T.N. et al. Infestin, a thrombin inhibitor presents in Triatoma infestans
midgut, a Chagas’ disease vector: gene clonin
g, expression and characterization of
the inhibitor. // Insect Biochem. Mol. Biol. 2002. Vol. 32, № 9. P. 991

997.

53.

Delaria K.A. et al. Characterization of placental bikunin, a novel human serine
protease inhibitor. // J. Biol. Chem. 1997. Vol. 272, № 1
8. P. 12209

12214.

54.

Earl S.T.H. et al. Identification and characterisation of Kunitz
-
type plasma
kallikrein inhibitors unique to Oxyuranus sp. snake venoms. // Biochimie. 2012.
Vol. 94, № 2. P. 365

373.

55.

Oliva M.L. et al. Leucaena leucocephala serine

proteinase inhibitor: primary
structure and action on blood coagulation, kinin release and rat paw edema. //
Biochim. Biophys. Acta. 2000. Vol. 1477, № 1
-
2. P. 64

74.

56.

Hayashi K. et al. Inhibition of serine proteases of the blood coagulation system by
squash family protease inhibitors. // J. Biochem. 1994. Vol. 116, № 5. P. 1013

1018.

57.

Ulmer J.S. et al. Ecotin is a potent inhibitor of the contact system proteases factor
XIIa and plasma kallikrein. // FEBS Lett. 1995. Vol. 365, № 2
-
3. P. 159

163.

58.

Hazegh
-
Azam M. et al. The corn inhibitor of activated Hageman factor:
purification and properties of two recombinant forms of the protein. // Protein
Expr. Purif. 1998. Vol. 13, № 2. P. 143

149.

59.

Luthy J.A. et al. Detailed mechanism of interaction of bo
vine
-
trypsin with
soybean trypsin inhibitor (Kunitz). I. Stopped flow measurements. // J. Biol.
Chem. 1973. Vol. 248, № 5. P. 1760

1771.

60.

Buczek O. et al. Analysis of serine proteinase
-
inhibitor interaction by alanine
shaving. // Protein Sci. 2002. Vol
. 11, № 4. P. 806

819.

61.

Laskowski M., Qasim M.A. What can the structures of enzyme
-
inhibitor
complexes tell us about the structures of enzyme substrate complexes? // Biochim.
Biophys. Acta. 2000. Vol. 1477, № 1
-
2. P. 324

337.

80



62.

Ardelt W., Laskowski M.

Effect of single amino acid replacements on the
thermodynamics of the reactive site peptide bond hydrolysis in ovomucoid third
domain. // J. Mol. Biol. 1991. Vol. 220, № 4. P. 1041

1053.

63.

Krowarsch D. et al. Canonical protein inhibitors of serine prote
ases // Cell Mol
Life Sci. 2003/11/20 ed. 2003. Vol. 60, № 11. P. 2427

2444.

64.

Nielsen K.J. et al. An 1H NMR determination of the three
-
dimensional structures
of mirror
-
image forms of a Leu
-
5 variant of the trypsin inhibitor from Ecballium
elaterium (EET
I
-
II). // Protein Sci. 1994. Vol. 3, № 2. P. 291

302.

65.

Beuning L.L., Spriggs T.W., Christeller J.T. Evolution of the proteinase inhibitor I
family and apparent lack of hypervariability in the proteinase contact loop. // J.
Mol. Evol. 1994. Vol. 39, № 6.

P. 644

654.

66.

Betzel C. et al. Structure of the proteinase inhibitor eglin c with hydrolysed
reactive centre at 2.0 A resolution. // FEBS Lett. 1993. Vol. 317, № 3. P. 185

188.

67.

Shaw G.L. et al. Backbone dynamics of chymotrypsin inhibitor 2: effect o
f
breaking the active site bond and its implications for the mechanism of inhibition
of serine proteases. // Biochemistry. 1995. Vol. 34, № 7. P. 2225

2233.

68.

Liu J. et al. Internal mobility of reactive
-
site
-
hydrolyzed recombinant Cucurbita
maxima trypsi
n inhibitor
-
V characterized by NMR spectroscopy: evidence for
differential stabilization of newly formed C
-

and N
-
termini. // Biochemistry. 1996.
Vol. 35, № 38. P. 12503

12510.

69.

Krishnamoorthi R., Lin C.L., VanderVelde D. Structural consequences of the
natural substitution, E9K, on reactive
-
site
-
hydrolyzed squash (Cucurbita maxima)
trypsin inhibitor (CMTI), as studied by two
-
dimensional NMR. // Biochemistry.
1992. Vol. 31, № 21. P. 4965

4969.

70.

Mahoney W.C. et al. Amino acid sequence and secondary stru
ctural analysis of
the corn inhibitor of trypsin and activated Hageman Factor // J Biol Chem.
1984/07/10 ed. 1984. Vol. 259, № 13. P. 8412

8416.

71.

Behnke C.A. et al. Structural determinants of the bifunctional corn Hageman
factor inhibitor: x
-
ray crystal

structure at 1.95 A resolution // Biochemistry.
1998/11/04 ed. 1998. Vol. 37, № 44. P. 15277

15288.

72.

Wang Y. et al. Cn3D: sequence and structure views for Entrez. // Trends Biochem.
Sci. 2000. Vol. 25, № 6. P. 300

302.

81



73.

Hojima Y., Pierce J. V, Pisan
o J.J. Hageman factor fragment inhibitor in corn
seeds: purification and characterization. // Thromb. Res. 1980. Vol. 20, № 2. P.
149

162.

74.

Swartz M.J. et al. Isolation and characterization of trypsin inhibitor from opaque
-
2
corn seeds // J Biol Chem. 1
977/11/25 ed. 1977. Vol. 252, № 22. P. 8105

8107.

75.

Burkhard R.K. et al. Thermodynamic measurements on the interaction of porcine
trypsin with single
-

and two
-
chain trypsin inhibitors from corn seeds // J Agric
Food Chem. 1979/03/01 ed. 1979. Vol. 27, №
2. P. 452

454.

76.

Lei M.G., Reeck G.R. Resynthesis by factor XIIa of the trypsin
-
cleaved peptide
bond in the corn protease inhibitor // Thromb Res. 1987/01/01 ed. 1987. Vol. 45,
№ 1. P. 87

94.

77.

Li J. et al. A small trypsin inhibitor from the frog of Od
orrana grahami //
Biochimie. 2008/05/13 ed. 2008. Vol. 90, № 9. P. 1356

1361.

78.

Li J. et al. Multiple bombesin
-
like peptides with opposite functions from skin of
Odorrana grahami // Genomics. 2007/01/06 ed. 2007. Vol. 89, № 3. P. 413

418.

79.

Ho S.N. et
al. Site
-
directed mutagenesis by overlap extension using the
polymerase chain reaction // Gene. 1989/04/15 ed. 1989. Vol. 77, № 1. P. 51

59.

80.

Froger A., Hall J.E. Transformation of plasmid DNA into E. coli using the heat
shock method // J Vis Exp. 2008/
11/11 ed. 2007. № 6. P. 253.

81.

Berman H.M. et al. The Protein Data Bank. // Nucleic Acids Res. 2000. Vol. 28,
№ 1. P. 235

242.

82.

Humphrey W., Dalke A., Schulten K. VMD: visual molecular dynamics. // J. Mol.
Graph. 1996. Vol. 14, № 1. P. 33

38, 27

28.

8
3.

Kabsch W., Sander C. Dictionary of protein secondary structure: pattern
recognition of hydrogen
-
bonded and geometrical features. // Biopolymers. 1983.
Vol. 22, № 12. P. 2577

2637.

84.

Phillips J.C. et al. Scalable molecular dynamics with NAMD // J Compu
t Chem.
2005. Vol. 26, № 16. P. 1781

1802.

85.

Best R.B. et al. Optimization of the additive CHARMM all
-
atom protein force
field targeting improved sampling of the backbone phi, psi and side
-
chain chi(1)
and chi(2) dihedral angles // J Chem Theory Comput.
2012. Vol. 8, № 9. P. 3257

3273.

82



86.

V. Sadovnichy


Vl. Voevodin, and V. Opanasenko A.T. “Lomonosov”:
Supercomputing at Moscow State University. In Contemporary High Performance
Computing: From Petascale toward Exascale (Chapman & Hall/CRC
Computational Sc
ience) // CRC Press. Boca Raton, USA. 2013. P. 283

307.

87.

Boratyn G.M. et al. BLAST: a more efficient report with usability improvements.
// Nucleic Acids Res. 2013. Vol. 41, № Web Server issue. P. W29

W33.

88.

Consortium T.U. Update on activities at the

Universal Protein Resource (UniProt)
in 2013. // Nucl Acids Res. 2013. Vol. 41. P. 43

47.

89.

Wu Y. et al. Structural insight into distinct mechanisms of protease inhibition by
antibodies // Proc Natl Acad Sci U S A. 2007. Vol. 104, № 50. P. 19784

19789.

90.

Sali A., Blundell T.L. Comparative protein modelling by satisfaction of spatial
restraints. // J. Mol. Biol. 1993. Vol. 234, № 3. P. 779

815.

91.

Comeau S.R. et al. ClusPro: a fully automated algorithm for protein
-
protein
docking // Nucleic Acids Res.
2004. Vol. 32, № Web Server issue. P. W96

W99.

92.

Comeau S.R. et al. ClusPro: an automated docking and discrimination method for
the prediction of protein complexes // Bioinformatics. 2004. Vol. 20, № 1. P. 45

50.

93.

Raveh B., London N., Schueler
-
Furman
O. Sub
-
angstrom modeling of complexes
between flexible peptides and globular proteins // Proteins. 2010. Vol. 78, № 9. P.
2029

2040.

94.

London N. et al. Rosetta FlexPepDock web server
--
high resolution modeling of
peptide
-
protein interactions // Nucleic Ac
ids Res. 2011. Vol. 39, № Web Server
issue. P. W249

W253.

95.

Fradera X. et al. High
-
resolution crystal structures of factor XIa coagulation factor
in complex with nonbasic high
-
affinity synthetic inhibitors // Acta Crystallogr
Sect F Struct Biol Cryst Com
mun. 2012. Vol. 68, № Pt 4. P. 404

408.

96.

Chelliah V., Blundell T.L., Fernández
-
Recio J. Efficient restraints for protein
-
protein docking by comparison of observed amino acid substitution patterns with
those predicted from local environment. // J. Mol. B
iol. 2006. Vol. 357, № 5. P.
1669

1682.

97.

Kozakov D. et al. How good is automated protein docking? // Proteins. 2013. Vol.
81, № 12. P. 2159

2166.

83



98.

Cheng T.M., Blundell T.L., Fernandez
-
Recio J. pyDock: electrostatics and
desolvation for effective scor
ing of rigid
-
body protein
-
protein docking // Proteins.
2007. Vol. 68, № 2. P. 503

515.

99.

Jimenez
-
Garcia B., Pons C., Fernandez
-
Recio J. pyDockWEB: a web server for
rigid
-
body protein
-
protein docking using electrostatics and desolvation scoring //
Bioinfo
rmatics. 2013. Vol. 29, № 13. P. 1698

1699.

100.

Bao W.
-
J. et al. Highly efficient expression and purification system of small
-
size
protein domains in Escherichia coli for biochemical characterization. // Protein
Expr. Purif. 2006. Vol. 47, № 2. P. 599

606
.

101.

Dahl A.C., Chavent M., Sansom M.S. Bendix: intuitive helix geometry analysis
and abstraction // Bioinformatics. 2012. Vol. 28, № 16. P. 2193

2194.

102.

McBride J.D. et al. Peptide mimics of the Bowman
-
Birk inhibitor reactive site
loop // Biopolymers
. 2002/09/27 ed. 2002. Vol. 66, № 2. P. 79

92.

103.

Brauer A.B. et al. The (1)H
-
NMR solution structure of the antitryptic core peptide
of Bowman
-
Birk inhibitor proteins: a minimal canonical loop // J Biomol Struct
Dyn. 2002/07/30 ed. 2002. Vol. 20, № 1. P.

59

70.

104.

Mucsi Z. et al. Structure
-
oriented rational design of chymotrypsin inhibitor
models // Protein Eng. 2003/10/16 ed. 2003. Vol. 16, № 9. P. 673

681.

105.

Chen Z.Y. et al. Inhibition of plant
-
pathogenic fungi by a corn trypsin inhibitor
overexpre
ssed in Escherichia coli // Appl Env. Microbiol. 1999/03/02 ed. 1999.
Vol. 65, № 3. P. 1320

1324.

106.

Tu B.P., Weissman J.S. Oxidative protein folding in eukaryotes: mechanisms and
consequences // J Cell Biol. 2004/02/06 ed. 2004. Vol. 164, № 3. P. 341

34
6.

107.

Toledano M.B. et al. The system biology of thiol redox system in Escherichia coli
and yeast: differential functions in oxidative stress, iron metabolism and DNA
synthesis // FEBS Lett. 2007/07/31 ed. 2007. Vol. 581, № 19. P. 3598

3607.

108.

Salinas

G. et al. Tuned Escherichia coli as a host for the expression of disulfide
-
rich proteins // Biotechnol J. 2011/05/14 ed. 2011. Vol. 6, № 6. P. 686

699.

109.

Faulkner M.J. et al. Functional plasticity of a peroxidase allows evolution of
diverse disulfide
-
r
educing pathways // Proc Natl Acad Sci U S A. 2008/05/06 ed.
2008. Vol. 105, № 18. P. 6735

6740.

84



Список сокращений и обозначений


C1INH

С1
-
ингибитор

CHFI

и
нгибитора трипсина из кукурузы (corn trypsin/factor XIIa inhibitor

EGF

эпиде
рмальным

фактором р
оста

HEPES

2
-
[4
-
(2
-
гидроксиэтил)
-
1
-
пиперазин]этансульфоновая кислота

HMWK

высокомолекулярным кининогеном

HRG

Гистидин
-
богатый гликопротеин

OD

оптическая плотность (optical density)

АТ

А
нтитромбин

БСА

бычий сывороточный альбумин

ДМСО

диметилсульфокс
ид

ДНК

дезоксирибонуклеиновая кислота

МД

молекулярная динамика

ПААГ

полиакриламидный гель

ПЦР

пол
и
меразная

цепная реакция

т.н.

так называемый

ТФ

тканевый фактор

фVII

фактор VII

фXI

фактора XI

фXIa

актив
ирован
ный фактор XI

фXII

фактора XII

фXIIa

активированный фактор XII

фXIII

фактор XIII

фXIIIа

активированный фактор XIII



Приложенные файлы

  • pdf 14930031
    Размер файла: 2 MB Загрузок: 0

Добавить комментарий