Eco ACCGTTCTTAATTCTGATATTTCATCGG Ype GTATTACTGAACGCTGATATTTCCGCGGTTATCTCCCGTCTGGGCCATACCGATCAGATT Паттерн нуклеотидных замен в белок-кодирующих


Чтобы посмотреть презентацию с картинками, оформлением и слайдами, скачайте ее файл и откройте в PowerPoint на своем компьютере.
Текстовое содержимое слайдов презентации:

Сравнительный анализ последовательностей ДНК БиБи 4 курсОсень 2005 Идентификация генов Новый геном => нет обучающей выборки«Псевдообучение»Длинные открытые рамки считывания (ОРС)Открытые рамки, гомологичные известным генам«Самосогласование»Режем на фрагменты, делим на два кластера, обучаемсяПредсказываемПереобучаемсяEtc. Сравнение с родственными геномамиCRITICA: (пара) ОРС=ген, если сходство на уровне аминокислотных последовательностей выше, чем можно было бы ожидать для формальных транслятов при заданном уровне сходства нуклеотидных последовательностей Sty AGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Sen AGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Stm GGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Eco AGGATTAAACTGTGGGTCAGCGAAACGTTTCGCTGATGGAGAA-AAAAATGAAAAAAGGC Ype TTTTCTAAACTCCTTGTTAGCGAAACGTTTCGCTCTTGGAGTA-GATCATGAAAAAAGGT ** *** **************** ***** * * ***** ***** Sty ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Sen ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Stm ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Eco ACCGTTCTTAATTCTGATATTTCATCGGTGATCTCCCGTCTGGGACATACCGATACGCTG Ype GTATTACTGAACGCTGATATTTCCGCGGTTATCTCCCGTCTGGGCCATACCGATCAGATT * ** ** **** ** ** **** ** *********** ***** *** * rbsD в энтеробактериях Sty AGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Sen AGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Stm GGGGTTACACTGCGGC-CAGCGAAACGTTTCGCTAGTGGAGCAGAAAAATGAAGAAAGGC Eco AGGATTAAACTGTGGGTCAGCGAAACGTTTCGCTGATGGAGAA-AAAAATGAAAAAAGGC Ype TTTTCTAAACTCCTTGTTAGCGAAACGTTTCGCTCTTGGAGTA-GATCATGAAAAAAGGT ** *** **************** ***** * * ***** ***** Sty ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Sen ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Stm ACCGTACTCAACTCTGAAATCTCGTCGGTCATTTCCCGTCTGGGGCATACTGATACTCTG Eco ACCGTTCTTAATTCTGATATTTCATCGGTGATCTCCCGTCTGGGACATACCGATACGCTG Ype GTATTACTGAACGCTGATATTTCCGCGGTTATCTCCCGTCTGGGCCATACCGATCAGATT * ** ** **** ** ** **** ** *********** ***** *** * rbsD в энтеробактериях: ответ Sty TCGCTCG--CAGCGGAAAGAGGATTACGCCCTTCGCCTGGAGGCTGTGCAGGGGC---GCCGGAGATGGGATGCATAATT Stm TCGCTCG--CAGCGGAAAGAGGATTACGCCCTTCGCCTGGAGGCTGTGCAGGGGC---GCCGGAGATGGGATGCATAATT Sen TCGCTCG--CAGCGGAAAGAGGATTACGCCCTTCGCCTGGAGGCTGTGCAGGGGC---GCCGGAGATGGGATGCATAATT Eco TTGCCCG--TGCCAGACGGCAGATTATCTCCCTGACCTGGTGGTTGCCCAGGAGGAGGGCCGGAAATAGGTTGTATCATT Kpn ----CGG--TGGCGCAGTGCCTGATGGG-CCTCGCCCTGGAGGACGGTCTGGCAT---ATCAGCAAGGGGGTGCGTCATG Ype TTGTTAGAACAGGGGAAAACGGTAAACAGTGTGGCATTAGATGTCGGTTATAGCT-----CCGCCTCTGCTTTTATCGCC * * * * * * * * * * * Sty AATTATCCTTTAAC----------CATAAATCTGAGCAATA-TATGCTTGGCGGCCAGATTATGGC--ACACTTGTCCGG Stm AATTATCCTTTAAC----------CATAAATCTGAGCAATA-TATGCCTGGCGGCCAGATTATGGC--ACACTTGTCCGG Sen AATTATCCTTTAAC----------CATAAATCTGAGCAATA-TATGCCTGGCGGCCAGATTATGGC--ACACTTGTCCGG Eco ACGTATCCTTATAC----------CTGAAATCTTCGCAAG--TATGCCTGGCCGCGAGATTATGGC--ACACTTGTCCGG Kpn ATTCATCCTTTCGATATCGCGGTGCTGGAACCAGGTGATGAGTATGCCTGGCGGCCAGATTATGGC--ACACTTCCCCAG Ype ATGTTTCAGCAAATAT--------CGGGTACCA-CGCCTGAGCGTTTCCGGCGGGGCAATAGTGGCTTATACTAAGCCCC * ** * * * * *** * ** **** * *** ** Sty TTAACTCTCGTT-CTCAAACAG------GTACGACAGTC--GTGAAAATTCTCGTTGATGAAAATATGCCTTACGCCCGC Stm TTAACTCTCGTT-CTCAAACAG------GTACGACAGTC--GTGAAAATTCTCGTTGATGAAAATATGCCTTACGCCCGC Sen TTAACTCTCGTT-CTCAAACAG------GTACGACAGTC--GTGAAAATTCTCGTTGATGAAAATATGCCTTACGCCCGC Eco TTAACTCTCGT--CTCATACAG------GTAACACAAAC--GTGAAAATCCTTGTTGATGAAAATATGCCTTATGCCCGC Kpn TTAACTCTCGTT-CTCAGACAG------GTACTGAACT---GTGAAAATCCTCGTTGATGAAAATATGCCCTATGCCCGT Ype CTGTTTTTCATCTGTATGGCAGTTCGCTGTCGGAGAGTAAAGTGAAAATTCTGGTTGATGAAAATATGCCGTACGCTGAG * * ** * * *** ** * ******** ** ***************** ** ** 123123123123123123123123123123123123123 Паттерн нуклеотидных заменв белок-кодирующих областях: pdxB в энтеробактериях Eco V_____QDEYYMARALKLAQRGRFTTHPNPNVGCVIVKDGEIVGEGYHQRAGEPHAEVHA QD +M RAL LA +G +TT PNP VGCV VK+GEIVGEG+H +AG+PHAE A Hin MLEFSSQDCVFMQRALDLAAKGQYTTTPNPSVGCVLVKNGEIVGEGFHFKAGQPHAERVA Eco GCGCGCCTGGAGGACTAA----G----------CCGTGCAGGAC-GAGTATTACATGGCGCGGGCGCTAA Hin GAAAAATTAAAGGATTAATTATGCTTGAATTTTCCTCACAAGATTGCGTATTT-ATGCAACGTGCCTTAG * * **** *** * ** ** ** * ***** *** ** ** ** Белковое выравнивание (ribD) Множественное выравнивание Эукариоты: сплайсированное выравнивание Ген с известными гомологами (Procrustes, GeneWise)Операция вставки интронаБлочная модельИспользование сходства (BLAST) как дополнительного параметра (GenomeScan)Отступление: динамическое программирование в задаче распознавания геновВершины – сайты, ребра – экзоны и интроныКвадратичное количество ребер, линейное время оценки веса ребраВершины – сайты («рельсовый граф»)Линейное количество реберГен без известных гомологов, но в двух геномахЭкзон-интронная структура в нуклеотидном выравнивании (Rosetta, SGP) Геномное сплайсированное выравнивание (Pro-Gene – динамическое программирование, DoubleScan – HMM распознавание+выравнивание, SLAM). Четвертая степень, если всякий раз выбирать оптимальный интрон, но внутри прямоугольника это делается один раз Динамическое программирование Match in exon Insertion in exon Match in exon Match in intron Match in intron Insertion in intron Match in exon Match in intron Match in exon Match in exon Inserted intron Matching intergenic region Matching intergenic interval HMM (DoubleScan) Регуляция транскрипции Phylogenetic footprinting – прокариоты. MENTERIC, Gibbs samplersPhylogenetic footprinting – эукариоты. rVISTAPhylogenetic shadowingПроверка соответствия (consistency check). Регулоги Low conservation in upstream region High conservation in upstream region Menteric Multiple sites (nrd genes): FNR, DnaA, NrdR nrdD:пром.DnaAFNR NrdR Phylogenetic Shadowing (E.Rubin’s lab) Ген apo(a) есть только у приматов Genome 2 Genome 1 Set of known sites Profile Genome N Consistency filtering: the basic procedure Accounting for the operon structure Упражнение: чем это плохо? Regulogger (W.Wasserman) микроРНК ~22 нуклеотидаКомплементарны мРНК (неточно, 3’-конец – животные; точно, кодирующая область - растения)Подавляют трансляцию или способствуют деградации мРНК (растения)Предшественник – шпилька специального вида, длина ~70 нт.Человек – минимум 800 (экспериментально > 200), дрозофила – 200, нематода – 100, растения – минимум сотняНезависимые гены (м.б. полицистронные) или в интронахРегулируют минимум треть генов человекаВ основном – гены развития? Как искать ЭкспериментальноКонсервативностьВ далеких геномахВ близких геномах – shadowingНаличие и консервативность мишеней (трудно, если в белок-кодирующей области)Синтения, кластеризация геновКластеризация сайтов в мРНК-мишеняхПроверка функции

Приложенные файлы

  • ppt 15107510
    Размер файла: 3 MB Загрузок: 0

Добавить комментарий